pX335-EN477
(Plasmid
#86232)
-
PurposeFor transient expression of spCas9-nickase and one sgRNA targeting the mouse CTCF locus. Use together with pX335-EN475.
-
Depositing Lab
-
Depositing OrganizationJ. David Gladstone Institutes
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86232 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 86232-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 86232-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepX335
-
Backbone manufacturerAddgene 42335
-
Modifications to backboneUse in combination with pX335-EN475
-
Vector typeMammalian Expression, Mouse Targeting
-
Selectable markersNONE
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namespCas9-nickase and sgRNA against mouse CTCF STOP Codon
-
gRNA/shRNA sequenceCTGGGGCCTTGCTCGGCACC
-
SpeciesM. musculus (mouse)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 86232-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 86232-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX335-EN477 was a gift from Benoit Bruneau (Addgene plasmid # 86232 ; http://n2t.net/addgene:86232 ; RRID:Addgene_86232) -
For your References section:
Targeted Degradation of CTCF Decouples Local Insulation of Chromosome Domains from Genomic Compartmentalization. Nora EP, Goloborodko A, Valton AL, Gibcus JH, Uebersohn A, Abdennur N, Dekker J, Mirny LA, Bruneau BG. Cell. 2017 May 18;169(5):930-944.e22. doi: 10.1016/j.cell.2017.05.004. 10.1016/j.cell.2017.05.004 PubMed 28525758
