eSpCas9(1.1)_No_FLAG_ATP1A1_G3
(Plasmid
#86611)
-
PurposeExpresses the ATP1A1 G3 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 4. Px330-like plasmid
-
Depositing Lab
-
Depositing OrganizationUniversite Laval
Located in Canada -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86611 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 86611-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 86611-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
- Total vector size (bp) 8439
-
Vector typeMammalian Expression, CRISPR ; Co-selection via HDR using ouabain
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
-
Alt nameeSpCas9(1.1)_No_FLAG
-
SpeciesS. pyogenes
-
Insert Size (bp)8439
-
MutationK848A, K1003A, & R1060A
- Promoter CBh
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer agggatggttggttggtggg
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 86611-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 86611-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eSpCas9(1.1)_No_FLAG_ATP1A1_G3 was a gift from Yannick Doyon (Addgene plasmid # 86611 ; http://n2t.net/addgene:86611 ; RRID:Addgene_86611) -
For your References section:
Marker-free coselection for CRISPR-driven genome editing in human cells. Agudelo D, Duringer A, Bozoyan L, Huard CC, Carter S, Loehr J, Synodinou D, Drouin M, Salsman J, Dellaire G, Laganiere J, Doyon Y. Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265. 10.1038/nmeth.4265 PubMed 28417998