-
PurposeLentivirus to stably express fluorescent protein in mammalian cells
-
Depositing Lab
-
Depositing OrganizationHarvard Medical School
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86680 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHAGE2 mCherry N-terminal
- Backbone size w/o insert (bp) 8200
- Total vector size (bp) 9907
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATL3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1623
-
Entrez GeneATL3 (a.k.a. HSN1F)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGTCTATATAAGCAGAGCTCG
- 3′ sequencing primer CATATAGACAAACGCACACC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byYoko Shibata
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE2 mCherry-Atl3 was a gift from Tom Rapoport (Addgene plasmid # 86680 ; http://n2t.net/addgene:86680 ; RRID:Addgene_86680) -
For your References section:
Cooperation of the ER-shaping proteins atlastin, lunapark, and reticulons to generate a tubular membrane network. Wang S, Tukachinsky H, Romano FB, Rapoport TA. Elife. 2016 Sep 13;5. pii: e18605. doi: 10.7554/eLife.18605. 10.7554/eLife.18605 PubMed 27619977