This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHAGE2 Lnp-mCherry
(Plasmid #86687)


Item Catalog # Description Quantity Price (USD)
Plasmid 86687 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pHAGE2 GFP N-terminal
  • Backbone size w/o insert (bp) 7700
  • Total vector size (bp) 9816
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    LNPK (a.k.a. KIAA1715, LNP, LNP1, Ul, ulnaless)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGTCTATATAAGCAGAGCTCG
  • 3′ sequencing primer CATATAGACAAACGCACACC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE2 Lnp-mCherry was a gift from Tom Rapoport (Addgene plasmid # 86687 ; ; RRID:Addgene_86687)
  • For your References section:

    Cooperation of the ER-shaping proteins atlastin, lunapark, and reticulons to generate a tubular membrane network. Wang S, Tukachinsky H, Romano FB, Rapoport TA. Elife. 2016 Sep 13;5. pii: e18605. doi: 10.7554/eLife.18605. 10.7554/eLife.18605 PubMed 27619977