-
PurposeExpresses ApoE2 in Mammalian cells
-
Depositing Lab
-
Depositing OrganizationMassachusetts General Hospital
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87085 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 87085-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 87085-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV4
- Backbone size w/o insert (bp) 5066
- Total vector size (bp) 6019
-
Vector typeMammalian Expression
-
Selectable markersunknown
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameApolipoprotein E2
-
Alt nameApoE2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)953
-
GenBank IDNG_007084.2
-
Entrez GeneAPOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCATTGACGTCAATGGGAGTTTG
- 3′ sequencing primer GGCACTGGAGTGGCAACTTC
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note, the ApoE plasmid used in the reference paper was in AAV backbone. The ApoE plasmid deposit here is not in AAV backbone.
DNA (Catalog # 87085-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 87085-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV4-ApoE2 was a gift from Bradley Hyman (Addgene plasmid # 87085 ; http://n2t.net/addgene:87085 ; RRID:Addgene_87085) -
For your References section:
Gene transfer of human Apoe isoforms results in differential modulation of amyloid deposition and neurotoxicity in mouse brain. Hudry E, Dashkoff J, Roe AD, Takeda S, Koffie RM, Hashimoto T, Scheel M, Spires-Jones T, Arbel-Ornath M, Betensky R, Davidson BL, Hyman BT. Sci Transl Med. 2013 Nov 20;5(212):212ra161. doi: 10.1126/scitranslmed.3007000. 10.1126/scitranslmed.3007000 PubMed 24259049