Skip to main content

pCMV4-ApoE2
(Plasmid #87085)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87085 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 87085-D50 50 μg of DNA in Tris buffer $495
DNA 87085-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCMV4
  • Backbone size w/o insert (bp) 5066
  • Total vector size (bp) 6019
  • Vector type
    Mammalian Expression
  • Selectable markers
    unknown

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Apolipoprotein E2
  • Alt name
    ApoE2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    953
  • GenBank ID
    NG_007084.2
  • Entrez Gene
    APOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CCATTGACGTCAATGGGAGTTTG
  • 3′ sequencing primer GGCACTGGAGTGGCAACTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note, the ApoE plasmid used in the reference paper was in AAV backbone. The ApoE plasmid deposit here is not in AAV backbone.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV4-ApoE2 was a gift from Bradley Hyman (Addgene plasmid # 87085 ; http://n2t.net/addgene:87085 ; RRID:Addgene_87085)
  • For your References section:

    Gene transfer of human Apoe isoforms results in differential modulation of amyloid deposition and neurotoxicity in mouse brain. Hudry E, Dashkoff J, Roe AD, Takeda S, Koffie RM, Hashimoto T, Scheel M, Spires-Jones T, Arbel-Ornath M, Betensky R, Davidson BL, Hyman BT. Sci Transl Med. 2013 Nov 20;5(212):212ra161. doi: 10.1126/scitranslmed.3007000. 10.1126/scitranslmed.3007000 PubMed 24259049