Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCMV4-ApoE3
(Plasmid #87086)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87086 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV4
  • Backbone size w/o insert (bp) 5039
  • Total vector size (bp) 5992
  • Vector type
    Mammalian Expression
  • Selectable markers
    unknown

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Apolipoprotein E3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    953
  • GenBank ID
    NG_007084.2
  • Entrez Gene
    APOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CCATTGACGTCAATGGGAGTTTG
  • 3′ sequencing primer GGCACTGGAGTGGCAACTTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

The plasmid used in the reference was in the AAV backbone. The plasmid deposit here is not in AAV backbone.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV4-ApoE3 was a gift from Bradley Hyman (Addgene plasmid # 87086 ; http://n2t.net/addgene:87086 ; RRID:Addgene_87086)
  • For your References section:

    Gene transfer of human Apoe isoforms results in differential modulation of amyloid deposition and neurotoxicity in mouse brain. Hudry E, Dashkoff J, Roe AD, Takeda S, Koffie RM, Hashimoto T, Scheel M, Spires-Jones T, Arbel-Ornath M, Betensky R, Davidson BL, Hyman BT. Sci Transl Med. 2013 Nov 20;5(212):212ra161. doi: 10.1126/scitranslmed.3007000. 10.1126/scitranslmed.3007000 PubMed 24259049