pCASCADE-gapAP1
(Plasmid
#87146)
-
PurposegapAP1 targeting guide RNA E. coli , Low Phosphate Induction
-
Depositing Lab
-
Depositing OrganizationDuke University
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87146 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCASCADE
-
Backbone manufacturerNone - Constructed in House
- Backbone size w/o insert (bp) 2500
- Total vector size (bp) 2903
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namegapAP1 guide array
-
gRNA/shRNA sequence1 Guide Array : E . coli gapA gene promoter 1
- Promoter E . coli ugpB gene promoter, low phosphate induction
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACCACGTCGTCCCTATCTG
- 3′ sequencing primer ATCTCCGCCCCGTTCGTAA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCASCADE-gapAP1 was a gift from Michael Lynch (Addgene plasmid # 87146 ; http://n2t.net/addgene:87146 ; RRID:Addgene_87146)