Skip to main content

FLS2-YFPn
(Plasmid #87165)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87165 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 87165-D50 50 μg of DNA in Tris buffer $495
DNA 87165-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pAMPAT-35S
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FLS2
  • Alt name
    FLAGELLIN-SENSITIVE 2
  • Species
    A. thaliana (mustard weed)
  • Entrez Gene
    FLS2 (a.k.a. AT5G46330, FLAGELLIN-SENSITIVE 2, MPL12.13, MPL12.8, MPL12_13)
  • Promoter 35s
  • Tag / Fusion Protein
    • YFPn (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGACGCACAATCCCACTATCCTTCGCA
  • 3′ sequencing primer CATTTGGAGAAGGACCTCGAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FLS2-YFPn was a gift from Silke Robatzek (Addgene plasmid # 87165 ; http://n2t.net/addgene:87165 ; RRID:Addgene_87165)
  • For your References section:

    Plasma membrane calcium ATPases are important components of receptor-mediated signaling in plant immune responses and development. Frei dit Frey N, Mbengue M, Kwaaitaal M, Nitsch L, Altenbach D, Haweker H, Lozano-Duran R, Njo MF, Beeckman T, Huettel B, Borst JW, Panstruga R, Robatzek S. Plant Physiol. 2012 Jun;159(2):798-809. doi: 10.1104/pp.111.192575. Epub 2012 Apr 25. 10.1104/pp.111.192575 PubMed 22535420