p_3xFLAG-Rpp25
(Plasmid
#87194)
-
PurposeExpression of ectopic 3xFLAG-Rpp25 construct from CMV promoter
-
Depositing Lab
-
Depositing OrganizationUniversity of Colorado, Boulder
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87194 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 87194-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 87194-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepU6
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xFLAG-Rpp25
-
SpeciesH. sapiens (human)
-
Insert Size (bp)686
-
Entrez GeneRPP25
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ataaccgtattaccgccatgcat
- 3′ sequencing primer gataatcaacctctggattacaa
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 87194-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 87194-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p_3xFLAG-Rpp25 was a gift from Thomas Cech (Addgene plasmid # 87194 ; http://n2t.net/addgene:87194 ; RRID:Addgene_87194) -
For your References section:
Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing. Goldfarb KC, Cech TR. Genes Dev. 2017 Jan 1;31(1):59-71. doi: 10.1101/gad.286963.116. Epub 2017 Jan 23. 10.1101/gad.286963.116 PubMed 28115465