hZMPSTE24-3FLAG_pQCXIP
(Plasmid #89759)

• Purpose: Human ZMPSTE24 mammalian expression vector. Retroviral bicistronic puromycin vector.
• Depositing Lab: Martin Dorf
• Publication: Fu et al J Exp Med. 2017 Feb 28. pii: jem.20161270. doi: 10.1084/jem.20161270.

Backbone

• Vector backbone: pQCXIP
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 7159
• Total vector size (bp): 8674
• Modifications to backbone: Insert cloned into AgeI and BamHI sites of pQCXIP backbone. [Agei - Kozak seq (ACC) - ZMPSTE24 CDS (1425bp) - 9bp (NotI spacer) - 3xFLAG epitopes - STOP codon].
• Vector type: Mammalian Expression, Retroviral ; Bicistronic expression: puromycin resistance transcript is downstream
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: This gene sometimes gives low DNA yields.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Homo sapiens zinc metallopeptidase STE24 (ZMPSTE24)
• Alt name: ZMPSTE24; HGPS; PRO1; FACE1; STE24; FACE-1; Ste24p
• Species: H. sapiens (human)
• Insert Size (bp): 1425
• Mutation: Y253H in ZMPSTE24 (see depositor comments below)
• GenBank ID: BC037283
• Entrez Gene: ZMPSTE24 (a.k.a. FACE-1, FACE1, HGPS, PRO1, RSDM1, STE24, Ste24p)
• Promoter: CMV
• Tags / Fusion Proteins:
  • non coding ACC Kozak sequence before ATG protein initiation (N terminal on backbone)
  • 9bp spacer (NotI site) - 3xFLAG epitopes - Stop codon (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: ACGCCATCCACGCTGTTTTGACCT
• 3′ sequencing primer: AAGCGGCTTCGGCCAGTAACGTTA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: cDNA clone MGC:33086 IMAGE:5269064

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Reverse primer gives poor quality sequence data due to intervening difficult sequence. ZMPSTE24 construct containing a Y253H mutation was used in our published experiments.