-
PurposeHuman ZMPSTE24 mammalian expression vector. Retroviral bicistronic puromycin vector.
-
Depositing Lab
-
Depositing OrganizationHarvard Medical School
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepQCXIP
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7159
- Total vector size (bp) 8674
-
Modifications to backboneInsert cloned into AgeI and BamHI sites of pQCXIP backbone. [Agei - Kozak seq (ACC) - ZMPSTE24 CDS (1425bp) - 9bp (NotI spacer) - 3xFLAG epitopes - STOP codon].
-
Vector typeMammalian Expression, Retroviral ; Bicistronic expression: puromycin resistance transcript is downstream
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsThis gene sometimes gives low DNA yields.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHomo sapiens zinc metallopeptidase STE24 (ZMPSTE24)
-
Alt nameZMPSTE24; HGPS; PRO1; FACE1; STE24; FACE-1; Ste24p
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1425
-
MutationY253H in ZMPSTE24 (see depositor comments below)
-
GenBank IDBC037283
-
Entrez GeneZMPSTE24 (a.k.a. FACE-1, FACE1, HGPS, PRO1, RSDM1, STE24, Ste24p)
- Promoter CMV
-
Tags
/ Fusion Proteins
- non coding ACC Kozak sequence before ATG protein initiation (N terminal on backbone)
- 9bp spacer (NotI site) - 3xFLAG epitopes - Stop codon (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ACGCCATCCACGCTGTTTTGACCT
- 3′ sequencing primer AAGCGGCTTCGGCCAGTAACGTTA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA clone MGC:33086 IMAGE:5269064
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reverse primer gives poor quality sequence data due to intervening difficult sequence. ZMPSTE24 construct containing a Y253H mutation was used in our published experiments.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hZMPSTE24-3FLAG_pQCXIP was a gift from Martin Dorf (Addgene plasmid # 89759 ; http://n2t.net/addgene:89759 ; RRID:Addgene_89759) -
For your References section:
ZMPSTE24 defends against influenza and other pathogenic viruses. Fu B, Wang L, Li S, Dorf ME. J Exp Med. 2017 Feb 28. pii: jem.20161270. doi: 10.1084/jem.20161270. 10.1084/jem.20161270 PubMed 28246125