pcDNA3-myc-FLNa S2152A
(Plasmid #8983)

• Depositing Lab: John Blenis
• Depositing Organization: Harvard Medical School
  Located in the United States of America
• Publication: Woo et al Mol Cell Biol. 2004 Apr . 24(7):3025-35.
• Citations: 13 Articles

Backbone

• Vector backbone: pcDNA3
• Backbone size w/o insert (bp): 5446
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Filamin A S2152A
• Alt name: Filamin A
• Alt name: FLNa
• Species: H. sapiens (human)
• Insert Size (bp): 8640
• Mutation: Ser2152Ala
• Entrez Gene: FLNA (a.k.a. ABP-280, ABPX, CSBS, CVD1, FGS2, FLN, FLN-A, FLN1, FMD, MNS, NHBP, OPD, OPD1, OPD2, XLVD, XMVD)
• Tag / Fusion Protein:
  • myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: T7
• 3′ sequencing primer: SP6

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

S2152A mutation made using Stratgene Quikchange mutagenesis kit. 5' FLNa-Ala2152 primer (GCAGGCGTCGGGCTCCTGCAGTGGCCAACGTTG) and 3' FLNa-Ala2152 primer (CAACGTTGGCCACTGCAGGAGCCCGACGCCTGC). See author's map for details of wild-type version of this plasmid.

DNA (Catalog # 8983-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 8983-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.