Skip to main content

BB2_L_EF_syn_BbsI
(Plasmid #89921)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89921 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    BB2_L_EF_syn_BbsI
  • Backbone size (bp) 2215
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CATTAATGCAGCTGGCAC
  • 3′ sequencing primer GGTTATTGTCTCATGAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene's sequencing results found that this vector is larger than other BB2 vectors. The depositing lab confirmed that, since the vector contains FS E and FS F sites, it should be functional for cloning purposes.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BB2_L_EF_syn_BbsI was a gift from Michael Sauer (Addgene plasmid # 89921 ; http://n2t.net/addgene:89921 ; RRID:Addgene_89921)
  • For your References section:

    An efficient tool for metabolic pathway construction and gene integration for Aspergillus niger. Sarkari P, Marx H, Blumhoff ML, Mattanovich D, Sauer M, Steiger MG. Bioresour Technol. 2017 May 4. pii: S0960-8524(17)30643-0. doi: 10.1016/j.biortech.2017.05.004. 10.1016/j.biortech.2017.05.004 PubMed 28533066