-
PurposeExpresses Insulin-GLuc from the rat insulin promoter. Gaussia Luc is inserted within the C-peptide and is co-secreted with insulin.
-
Depositing Lab
-
Depositing OrganizationUniversity of Texas Southwestern Medical Center
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 89928-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 89928-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1+rInsp
-
Backbone manufacturerInvitrogen (CMV removed)
- Backbone size w/o insert (bp) 5091
- Total vector size (bp) 5965
-
Modifications to backboneCMV promoter was excised using MluI/NheI digest and rat Insulin II promoter was inserted at the same sites.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman insulin-Gaussia-Luciferase
-
Alt namehIns-GLuc
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)849
-
MutationDNA sequence for Gaussia luciferase was humanized and two mutations (M43I/M110I) were made to enhance glow-like kinetics.
-
Entrez GeneINS (a.k.a. IDDM, IDDM1, IDDM2, ILPR, IRDN, MODY10, PNDM4)
- Promoter rat Insulin II promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GTCGACGGATCGGGAGAT
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGeneArt Gene Synthesis (Life Technologies) was used to assemble human insulin with humanized Gaussia luciferase inserted into the C-peptide.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 89928-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 89928-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1+(rInsp)-Ins-GLuc was a gift from Melanie Cobb (Addgene plasmid # 89928 ; http://n2t.net/addgene:89928 ; RRID:Addgene_89928) -
For your References section:
Insulin promoter-driven Gaussia luciferase-based insulin secretion biosensor assay for discovery of beta-cell glucose-sensing pathways. Kalwat MA, Wichaidit C, Nava Garcia AY, McCoy MK, McGlynn K, Hwang IH, MacMillan JB, Posner BA, Cobb MH. ACS Sens. 2016 Oct 28;1(10):1208-1212. Epub 2016 Oct 12. 10.1021/acssensors.6b00433 PubMed 27819058