Skip to main content

pCMV MN (eGFP)
(Plasmid #89932)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89932 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 89932-D50 50 μg of DNA in Tris buffer $495
DNA 89932-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 4156
  • Total vector size (bp) 5023
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MN
  • Alt name
    NLS-HA-MN
  • Insert Size (bp)
    867
  • Mutation
    M.SssI residues 2-272 fragment
  • GenBank ID
    X17195
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTGTACGGTGGGAGG
  • 3′ sequencing primer gcttgccaaacctacaggtgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Does not contain active methylatransferase - general cloning strains can be used.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV MN (eGFP) was a gift from Carl Novina (Addgene plasmid # 89932 ; http://n2t.net/addgene:89932 ; RRID:Addgene_89932)
  • For your References section:

    Targeted DNA methylation in human cells using engineered dCas9-methyltransferases. Xiong T, Meister GE, Workman RE, Kato NC, Spellberg MJ, Turker F, Timp W, Ostermeier M, Novina CD. Sci Rep. 2017 Jul 27;7(1):6732. doi: 10.1038/s41598-017-06757-0. 10.1038/s41598-017-06757-0 [pii] PubMed 28751638