pMST1212_BB2_E_BC_pcoxA:pyrGtrunc_AMA1_2.8
(Plasmid
#90286)
-
PurposeBB2 with split pyrG marker for homologous integration with linker BC (for 1 expression cassette)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 90286 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneBB2_L_BC_syn_BbsI
- Backbone size w/o insert (bp) 2215
- Total vector size (bp) 7070
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepyrGtrunc
-
SpeciesA .niger
-
Insert Size (bp)679
-
Mutationtruncated version of pyrG gene (sequence is from 5' region)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CATTAATGCAGCTGGCAC
- 3′ sequencing primer GGTTATTGTCTCATGAGCGG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMST1212_BB2_E_BC_pcoxA:pyrGtrunc_AMA1_2.8 was a gift from Michael Sauer (Addgene plasmid # 90286 ; http://n2t.net/addgene:90286 ; RRID:Addgene_90286) -
For your References section:
An efficient tool for metabolic pathway construction and gene integration for Aspergillus niger. Sarkari P, Marx H, Blumhoff ML, Mattanovich D, Sauer M, Steiger MG. Bioresour Technol. 2017 May 4. pii: S0960-8524(17)30643-0. doi: 10.1016/j.biortech.2017.05.004. 10.1016/j.biortech.2017.05.004 PubMed 28533066