Skip to main content

pL452(hygro)-Sf3b1-K700K
(Plasmid #90426)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90426 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 90426-D50 50 μg of DNA in Tris buffer $495
DNA 90426-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pL452
  • Backbone size w/o insert (bp) 4823
  • Modifications to backbone
    Neomycin resistance cassette in original pL452 vector substituted with hygromycin resistance cassette, enabling dual selection
  • Vector type
    homology-directed repair vector
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sf3b1 - left and right homology arms
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    800
  • Entrez Gene
    Sf3b1 (a.k.a. 155kDa, 2810001M05Rik, Prp10, SAP155, SF3b155, TA-8, Targ4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal1 (left arm); BamH1 (right arm) (not destroyed)
  • 3′ cloning site EcoR1 (left arm); Not1 (right arm) (not destroyed)
  • 5′ sequencing primer TCACTAAAGGGAACAAAAGC (left arm); TCGACTAGAGCTTGCGGA (right arm)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pL452(hygro)-Sf3b1-K700K was a gift from Alex Minella (Addgene plasmid # 90426 ; http://n2t.net/addgene:90426 ; RRID:Addgene_90426)
  • For your References section:

    Degenerate minigene library analysis enables identification of altered branch point utilization by mutant splicing factor 3B1 (SF3B1). Gupta AK, Murthy T, Paul KV, Ramirez O, Fisher JB, Rao S, Rosenberg AB, Seelig G, Minella AC, Pillai MM. Nucleic Acids Res. 2018 Nov 20. pii: 5193340. doi: 10.1093/nar/gky1161. 10.1093/nar/gky1161 PubMed 30462273