CDC45 B9.2 gRNA
(Plasmid
#90594)
-
Purpose3rd generation lentiviral gRNA plasmid targeting human CDC45
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 90594 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti-sgRNA
-
Backbone manufacturerEric Lander & David Sabatini labs (Addgene plasmid #71409)
- Backbone size w/o insert (bp) 9151
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCDC45 (Guide Designation B9.2)
-
Alt namepKMKO series
-
gRNA/shRNA sequenceCACCGAACCAGCGTATATTGCACG
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')
- 3′ sequencing primer EF1a-R (5'-CACGGCGACTACTGCACTTA-3')
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that gRNA target sequence listed is not strictly the 20nt spacer sequence, but also contains the 5' BsmBI overhang. For more information about knockout human cell lines generated using this plasmid, please see http://cellcycleknockouts.wi.mit.edu/ .
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CDC45 B9.2 gRNA was a gift from Iain Cheeseman (Addgene plasmid # 90594 ; http://n2t.net/addgene:90594 ; RRID:Addgene_90594) -
For your References section:
Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. McKinley KL, Cheeseman IM. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16. 10.1016/j.devcel.2017.01.012 PubMed 28216383