Skip to main content

pPN023
(Plasmid #91671)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91671 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 91671-D50 50 μg of DNA in Tris buffer $495
DNA 91671-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUC19-U6 promoter
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SYNGAP1
  • Alt name
    NM_006772.2
  • gRNA/shRNA sequence
    ATAGAGGGTCCCCGTACATC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    21
  • Entrez Gene
    SYNGAP1 (a.k.a. MRD5, RASA1, RASA5, SYNGAP)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer M13F (-21)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPN023 was a gift from Lindy Barrett (Addgene plasmid # 91671 ; http://n2t.net/addgene:91671 ; RRID:Addgene_91671)
  • For your References section:

    A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Hazelbaker DZ, Beccard A, Bara AM, Dabkowski N, Messana A, Mazzucato P, Lam D, Manning D, Eggan K, Barrett LE. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006. 10.1016/j.stemcr.2017.09.006 PubMed 29020615