-
PurposeExpresses H2B protein tagged with eGFP
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 91776 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneHIV-H2B-mRFP
- Backbone size w/o insert (bp) 8054
- Total vector size (bp) 8091
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman Histone H2B / eGFP
-
Alt nameHIST1H2BJ
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1135
-
Entrez GeneH2BC11 (a.k.a. H2B/r, H2BFR, H2BJ, HIST1H2BJ)
- Promoter EF1a
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer atcatgaattcgtttgtgaacgacattttcgagcg
- 3′ sequencing primer atcgatGTCGCGGCCGCTTTACTTGTACA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe used the H2B-GFP plasmid from Geoff Wahl (Addgene plasmid # 11680) as donor vector
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The HIV-H2BeGFP plasmid was cloned by replacing mRFP in HIV-H2B-mRFP (Bryan Welm & Zena Werb Addgene plasmid # 18982 ) with H2BeGFP from H2B-GFP plasmid (Geoff Wahl Addgene plasmid # 11680) to generate a bicistronic lentiviral vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHIV-H2B-eGFP was a gift from Maria Pia Cosma (Addgene plasmid # 91776 ; http://n2t.net/addgene:91776 ; RRID:Addgene_91776) -
For your References section:
Mesenchymal stem cells generate distinct functional hybrids in vitro via cell fusion or entosis. Sottile F, Aulicino F, Theka I, Cosma MP. Sci Rep. 2016 Nov 9;6:36863. doi: 10.1038/srep36863. 10.1038/srep36863 PubMed 27827439