iRFP-PAmCherry1-PH_PLCd1
(Plasmid
#92167)
-
PurposePI(4,5)P2 single molecule fluorescent reporter
-
Depositing Lab
-
Depositing OrganizationUniversity of Wisconsin, Madison
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92167 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 92167-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 92167-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-N1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiRFP-PAmCherry1-PH_PLCd1
-
Insert Size (bp)2000
- Promoter CMV
-
Tag
/ Fusion Protein
- iRFP-PAmCherry1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GTCGCGGCCGCTTACTCCTTCAGGAAGTTCT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 92167-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 92167-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
iRFP-PAmCherry1-PH_PLCd1 was a gift from Xuelin Lou (Addgene plasmid # 92167 ; http://n2t.net/addgene:92167 ; RRID:Addgene_92167) -
For your References section:
Nanoscale Landscape of Phosphoinositides Revealed by Specific Pleckstrin Homology (PH) Domains Using Single-molecule Superresolution Imaging in the Plasma Membrane. Ji C, Zhang Y, Xu P, Xu T, Lou X. J Biol Chem. 2015 Nov 6;290(45):26978-93. doi: 10.1074/jbc.M115.663013. Epub 2015 Sep 22. 10.1074/jbc.M115.663013 PubMed 26396197