Skip to main content

shNg Lenti FHRC3J1UGW
(Plasmid #92233)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92233 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    FUGW
  • Backbone manufacturer
    David Baltimore (Addgene plasmid # 14883)
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    shRNA targeting Ng
  • gRNA/shRNA sequence
    GTGACAAGACTTCCCTACTGT
  • Species
    H. sapiens (human)
  • Promoter H1

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    shNg Lenti FHRC3J1UGW was a gift from Weifeng Xu (Addgene plasmid # 92233 ; http://n2t.net/addgene:92233 ; RRID:Addgene_92233)
  • For your References section:

    Neurogranin, Encoded by the Schizophrenia Risk Gene NRGN, Bidirectionally Modulates Synaptic Plasticity via Calmodulin-Dependent Regulation of the Neuronal Phosphoproteome. Hwang H, Szucs MJ, Ding LJ, Allen A, Ren X, Haensgen H, Gao F, Rhim H, Andrade A, Pan JQ, Carr SA, Ahmad R, Xu W. Biol Psychiatry. 2021 Feb 1;89(3):256-269. doi: 10.1016/j.biopsych.2020.07.014. Epub 2020 Jul 29. 10.1016/j.biopsych.2020.07.014 PubMed 33032807