Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #126462)


Item Catalog # Description Quantity Price (USD)
Plasmid 126462 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 7914
  • Total vector size (bp) 5758
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    L7-6, Purkinje cell specific promoter
  • Alt name
    pcp2 promoter
  • Species
    M. musculus (mouse)
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer L7-6-rev, GGGGAGGGGGAGCAGATATC
  • 3′ sequencing primer GFP-rev, ACTTGTGGCCGTTTACGTCGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV/L7-6-GFP-WPRE was a gift from Hirokazu Hirai (Addgene plasmid # 126462 ; ; RRID:Addgene_126462)
  • For your References section:

    Minimal Purkinje Cell-Specific PCP2/L7 Promoter Virally Available for Rodents and Non-human Primates. Nitta K, Matsuzaki Y, Konno A, Hirai H. Mol Ther Methods Clin Dev. 2017 Jul 27;6:159-170. doi: 10.1016/j.omtm.2017.07.006. eCollection 2017 Sep 15. S2329-0501(17)30089-X [pii] PubMed 28828391