-
PurposeAn AAV vector that expresses GFP under the control of the L7-6 promoter. The L7-6 promoter is the short size (0.8-kb) and has highly specificity to Purkinje cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 7914
- Total vector size (bp) 5758
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameL7-6, Purkinje cell specific promoter
-
Alt namepcp2 promoter
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)844
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer L7-6-rev, GGGGAGGGGGAGCAGATATC
- 3′ sequencing primer GFP-rev, ACTTGTGGCCGTTTACGTCGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe gene origin of L7-6 promoter is L7-4 promoter that is described in the paper (Nitta et al, 2017).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the Addgene verified sequence contains a truncated ITR compared to the depositor's reference sequence. This truncation was present in the original stock and still worked well for AAV packaging.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV/L7-6-GFP-WPRE was a gift from Hirokazu Hirai (Addgene plasmid # 126462 ; http://n2t.net/addgene:126462 ; RRID:Addgene_126462) -
For your References section:
Minimal Purkinje Cell-Specific PCP2/L7 Promoter Virally Available for Rodents and Non-human Primates. Nitta K, Matsuzaki Y, Konno A, Hirai H. Mol Ther Methods Clin Dev. 2017 Jul 27;6:159-170. doi: 10.1016/j.omtm.2017.07.006. eCollection 2017 Sep 15. S2329-0501(17)30089-X [pii] PubMed 28828391