Skip to main content

p-mCherry-N1-iChloC_CA
(Plasmid #98171)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98171 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 98171-D50 50 μg of DNA in Tris buffer $495
DNA 98171-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 4733
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Synthetic construct iChloC_C128A gene
  • Alt name
    iChloC
  • Alt name
    CrChR2
  • Species
    Synthetic
  • Insert Size (bp)
    927
  • Mutation
    E83Q, E90R, E101S, C128A, T159C, D156N
  • Promoter CMV (+enhancer)
  • Tag / Fusion Protein
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer EGFP-N1-F: GAGGTCTATATAAGCAGAGC or CMV-F: GCAAATGGGCGGTAGGCGT
  • 3′ sequencing primer EGFP-C1-R: AACCATTATAAGCTGCAATAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Modifications to backbone: EGFP has been replaced by inserting the complete fusion construct (ChR2-mCherry) using XbaI and BamHI cloning sites.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p-mCherry-N1-iChloC_CA was a gift from Peter Hegemann (Addgene plasmid # 98171 ; http://n2t.net/addgene:98171 ; RRID:Addgene_98171)
  • For your References section:

    Anion-conducting channelrhodopsins with tuned spectra and modified kinetics engineered for optogenetic manipulation of behavior. Wietek J, Rodriguez-Rozada S, Tutas J, Tenedini F, Grimm C, Oertner TG, Soba P, Hegemann P, Wiegert JS. Sci Rep. 2017 Nov 2;7(1):14957. doi: 10.1038/s41598-017-14330-y. 10.1038/s41598-017-14330-y PubMed 29097684