pRSETa-mKikGR-V69T
(Plasmid
#98574)
-
Purposephotoconvertible fluorescent protein mKikGR-V69T in pRSetA plasmid, photoconvertible by primed conversion mechanism, bacterial overexpression, sequence is codon optimised for E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98574 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRsetA
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemKikGR-V69T
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer T7 term (GCTAGTTATTGCTCAGCGG)
- 3′ sequencing primer T7 (TAATACGACTCACTATAGGG)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made by10.1073/pnas.1406593111 in different backbone
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSETa-mKikGR-V69T was a gift from Ulrike Endesfelder (Addgene plasmid # 98574 ; http://n2t.net/addgene:98574 ; RRID:Addgene_98574) -
For your References section:
A general mechanism of photoconversion of green-to-red fluorescent proteins based on blue and infrared light reduces phototoxicity in live-cell single-molecule imaging. Turkowyd B, Balinovic A, Virant D, Golz Carnero HG, Caldana F, Endesfelder M, Bourgeois D, Endesfelder U. Angew Chem Int Ed Engl. 2017 Jun 2. doi: 10.1002/anie.201702870. 10.1002/anie.201702870 PubMed 28574633