-
PurposeGenome engineering of virulent phages
-
Depositing Lab
-
Depositing OrganizationUniversite Laval
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98841 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 98841-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 98841-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTRKL2
- Backbone size w/o insert (bp) 6419
- Total vector size (bp) 12221
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB5-alpha
-
Growth instructionsGrowth medium: BHI + Erythromycin 150 µg/ml.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nametracr/Cas9
-
Insert Size (bp)5802
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCATATTAAACTAATTTCGGAGGTC
- 3′ sequencing primer CTGTATTACTGCATTTATTAAGAGTATTATACC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original gene was cloned by Luciano Marrafini and received from Addgene #42876.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note from the paper of O'Sullivan, and Klaenhammer: We found that BHI (Difco Laboratories, Detroit, MI, USA) was an excellent selection medium for ErR in E. coli. Unlike LB medium, BHI plates containing 150µg Er/ml afforded a clean selection, with no background colonies appearing even upon prolonged incubaction of one week or more.
O'Sullivan, D.J., T.R. Klaenhammer. 1993. High- and low-copy-number Lactococcus shuttle cloning vectors with features for clone screening. Gene 137:227-231.
DNA (Catalog # 98841-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 98841-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL2Cas9 was a gift from Sylvain Moineau (Addgene plasmid # 98841 ; http://n2t.net/addgene:98841 ; RRID:Addgene_98841) -
For your References section:
Genome Engineering of Virulent Lactococcal Phages Using CRISPR-Cas9. Lemay ML, Tremblay DM, Moineau S. ACS Synth Biol. 2017 Mar 30. doi: 10.1021/acssynbio.6b00388. 10.1021/acssynbio.6b00388 PubMed 28324650
Map uploaded by the depositor.
