Skip to main content
Addgene
Open Menu

Dynamic association of H3K36me3 with pericentromeric heterochromatin regulates its replication time.

Pradhan SK, Zhang H, Kolobynina KG, Rapp A, Arroyo M, Cardoso MC
EMBO Rep. 2025 Oct;26(20):4950-4976. doi: 10.1038/s44319-025-00575-6. Epub 2025 Sep 8. (Link opens in a new window) PubMed (Link opens in a new window) Article

Plasmids from Article

ID Plasmid Purpose
241429pc2099-pEGFP-H3.1Expresses human Histone H3.1 as fusion to GFP constructed by PCR using Primers: h3.1-cl-fw (AAGAATTCAATGGCTCGTACGAAGCAAAC) and h3.1-cl-rv (AAGCGGCCGCTGCCCTTTCCCCACGGATG) cloned into pEGFP-C1
241430pc5139-pEGFP-H3.1-K36MExpresses human Histone H3.1 as fusion to GFP with lysine to methionine point mutation of K36 from plasmid H3.1 using primers: forward: ACCGGTGGCGTGATGAAACCTCATCGC & reverse: GCGATGAGGTTTCATC

Antibodies from Article