FOLH1
Addgene Alerts
You can receive an email alert when new materials related to this gene are available at Addgene.
Log in to manage alertsPlasmids Related To This Gene
| ID | Plasmid | Gene/Insert | PI |
|---|---|---|---|
| 11524 | pAcGP67A-PSMA | prostate-specific membrane antigen (Homo sapiens) | Pamela Bjorkman |
| 217345 | gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1) | crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (Homo sapiens), crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (Homo sapiens), crFOLH1-1 gRNA: gctccagacctggggtccagttt (Homo sapiens), crCD151-3 gRNA: cgggaggccgcacccaccgcctg (Homo sapiens), crHBG-3 gRNA: ttcttcatccctagccagccgcc (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) | Luke Gilbert |
Antibodies Related To This Gene
| ID | Antibody | Target Antigen (Species) | PI |
|---|---|---|---|
| 203885 | Anti-Glutamate carboxypeptidase 2 [J591] |
Glutamate carboxypeptidase 2 (Homo sapiens)
|
Melina Fan |