|
|
187681 |
pCMV-Pom121 mScarlet |
Pom121 (Mus musculus)
|
Beckerle |
Sep 09, 2022 |
|
|
187685 |
pCMV-SUN2 mScarlet |
SUN2 (Mus musculus)
|
Beckerle |
Sep 09, 2022 |
|
|
190041 |
pC3.1-caggs-Crimson-CAAX |
Crimson (Other)
|
Lin |
Sep 09, 2022 |
|
|
188968 |
pT-GFP-rG2 |
GFP (Synthetic), sgRNA: agtccatgtaatcagcgtctactagt
|
Lee |
Sep 09, 2022 |
|
|
179485 |
pSF11-wmiRFP2-T2A-HO1 |
wmIRFP2-T2A-HO1 (Homo sapiens)
|
Piatkevich |
Sep 09, 2022 |
|
|
178972 |
pKeratin-emiRFP2-N1 |
Keratin-emiRFP2 (Homo sapiens)
|
Piatkevich |
Sep 09, 2022 |
|
|
187690 |
pE-mApple L5L2 |
mApple (Other)
|
Beckerle |
Sep 09, 2022 |
|
|
187675 |
pcDNA-SUN1 EGFP |
SUN1 (Mus musculus)
|
Beckerle |
Sep 09, 2022 |
|
|
173812 |
pITGA5_1745G>U |
NT1745 ITGA5 point mutation (Homo sapiens)
|
Siedlecki |
Sep 09, 2022 |
|
|
173811 |
pITGA5_473G>A |
NT473 ITGA5 point mutation (Homo sapiens)
|
Siedlecki |
Sep 09, 2022 |
|
|
187678 |
pcDNA-SUN2 EGFP |
SUN2 (Mus musculus)
|
Beckerle |
Sep 09, 2022 |
|
|
187684 |
pCMV-SUN2 GFP |
SUN2 (Mus musculus)
|
Beckerle |
Sep 09, 2022 |
|
|
187912 |
pSAC212 |
ade2 KO CRISPEY cassette (Synthetic)
|
Fraser |
Sep 09, 2022 |
|
|
187677 |
pcDNA-SUN1 mScarlet |
SUN1 (Mus musculus)
|
Beckerle |
Sep 09, 2022 |
|
|
189957 |
pLKO.1-Tet-Puro-shMMERVK9c_1 (inducible) |
ERV_MMERVK9c (Mus musculus)
|
Hnisz |
Sep 09, 2022 |
|
|
189956 |
pLKO.1-Tet-Puro-shMMERVK10c_2 (inducible) |
ERV_MMERVK10c (Mus musculus)
|
Hnisz |
Sep 09, 2022 |
|
|
189954 |
pLKO.1-Tet-Puro-shMMETn_2 (inducible) |
ERV_MMETn (Mus musculus)
|
Hnisz |
Sep 09, 2022 |
|
|
189953 |
pLKO.1-Tet-Puro-shMMETn_1 (inducible) |
ERV_MMETn (Mus musculus)
|
Hnisz |
Sep 09, 2022 |
|
|
189958 |
pLKO.1-Tet-Puro-shMMERVK9c_2 (inducible) |
ERV_MMERVK9c (Mus musculus)
|
Hnisz |
Sep 09, 2022 |
|
|
189955 |
pLKO.1-Tet-Puro-shMMERVK10c_1 (inducible) |
ERV_MMERVK10c (Mus musculus)
|
Hnisz |
Sep 09, 2022 |
|
|
178343 |
ER-CanlonicSF |
ER-CanlonicSF (Synthetic)
|
San Martín |
Sep 09, 2022 |
|
|
178342 |
CanlonicSF |
CanlonicSF (Synthetic)
|
San Martín |
Sep 09, 2022 |
|
|
187680 |
pCMV-Pom121 GFP |
Pom121 (Mus musculus)
|
Beckerle |
Sep 09, 2022 |
|
|
184247 |
ATX3-JD |
Ataxin-3 Josephin domain (Homo sapiens)
|
Macedo Ribeiro |
Sep 09, 2022 |
|
|
184246 |
ATX3-D1 |
Ataxin-3 Josephin domain and UIM1 (Homo sapiens)
|
Macedo Ribeiro |
Sep 09, 2022 |
|
|
187676 |
pcDNA-SUN1 mApple |
SUN1 (Mus musculus)
|
Beckerle |
Sep 09, 2022 |
|
|
186691 |
pBFC0625 |
tnsA (Other), tnsB (Other), tnsC (Other), tnsD (Other), tniQ (Other), cas8-cas5 fusion (Other), cas7 (Other), cas6 (Other), Vc_lacZ_α_1 Spacer crRNA (Other), Tn7 transposon (Other), GmR+sfGFP VcDART Cargo
|
Doudna |
Sep 09, 2022 |
|
|
186694 |
pBFC1207 |
tnsA (Other), tnsB (Other), tnsC (Other), tnsD (Other), tniQ (Other), cas8-cas5 fusion (Other), cas7 (Other), cas6 (Other), Vc_2xBsaI_NT (Guide Stuffer) crRNA (Other), Tn7 transposon (Other), GmR+sfGFP VcDART Cargo, SbfI+AsiSI dual restriction site for donor plasmid removal during ET-Seq
|
Doudna |
Sep 09, 2022 |
|
|
174506 |
pMT335-mScarletI |
mScarletI (Other)
|
Manley |
Sep 09, 2022 |
|
|
174505 |
Pxyl-ftsZ-sfGFP |
ftsZ (Other)
|
Manley |
Sep 09, 2022 |
|
|
186692 |
pBFC0687 |
tnsB (Other), tnsC (Other), tniQ (Other), Cas12k (Other), Sh_2xBsaI_NT (Guide Stuffer) gRNA (Other), Tn7 transposon (Other), GmR+sfGFP ShDART Cargo
|
Doudna |
Sep 09, 2022 |
|
|
186693 |
pBFC0694 |
tnsB (Other), tnsC (Other), tniQ (Other), Cas12k (Other), Sh_lacZ_α_1 gRNA (Other), Tn7 transposon (Other), GmR+sfGFP ShDART Cargo
|
Doudna |
Sep 09, 2022 |
|
|
186695 |
pBFC0996 |
tnsA (Other), tnsB (Other), tnsC (Other), tnsD (Other), tniQ (Other), cas8-cas5 fusion (Other), cas7 (Other), cas6 (Other), crRNA (Other), Tn7 transposon (Other), 2xLguI Cargo Stuffer, SbfI+AsiSI dual restriction site for donor plasmid removal during ET-Seq
|
Doudna |
Sep 09, 2022 |
|
|
164477 |
psfGFP-LAMP1-mCherry (pHLARE) |
LAMP1 (Rattus norvegicus)
|
Barber |
Sep 09, 2022 |
|
|
181739 |
pBPK1520-SNCA-A53T-ng |
Prime editing ngRNA for SNCA-A53T (Homo sapiens)
|
Hockemeyer |
Sep 08, 2022 |
|
|
181738 |
pU6-pegRNA-SNCA-A53T |
Prime editing pegRNA for SNCA-A53T (Synthetic)
|
Hockemeyer |
Sep 08, 2022 |
|
|
180019 |
pBPK1520-HEK3-CTTins-ng |
Prime editing ngRNA for HEK3-CTTins (Homo sapiens)
|
Hockemeyer |
Sep 08, 2022 |
|
|
180018 |
pBPK1520-SNCA-A30P-ng |
Prime editing ngRNA for SNCA-A30P (Homo sapiens)
|
Hockemeyer |
Sep 08, 2022 |
|
|
180017 |
pU6-pegRNA-HEK3-CTTins-px330-scaffold |
Prime editing pegRNA for HEK3-CTTins, with px330 scaffold (Synthetic)
|
Hockemeyer |
Sep 08, 2022 |
|
|
180016 |
pU6-pegRNA-SNCA-A30P |
Prime editing pegRNA for SNCA-A30P (Synthetic)
|
Hockemeyer |
Sep 08, 2022 |
|
|
180015 |
pET30a(+)-PE2 |
PE2 (Synthetic)
|
Hockemeyer |
Sep 08, 2022 |
|
|
180014 |
AAVS1-SA-neo-CAGGS-PE2-2A-GFP |
PE2-2A-GFP (Synthetic)
|
Hockemeyer |
Sep 08, 2022 |
|
|
188943 |
pET28-his6-HA3-HALO |
his6-HA3-HALO (Synthetic)
|
Buratowski |
Sep 08, 2022 |
|
|
188942 |
pET28-his6-HA3-CLIP |
his6-HA3-CLIP (Synthetic)
|
Buratowski |
Sep 08, 2022 |
|
|
183927 |
PHR-GFP-VP16 |
PHR-GFP-VP16 (Arabidopsis thaliana)
|
Rippe |
Sep 08, 2022 |
|
|
188941 |
pET28-his6-HA3-SNAPf |
his6-HA3-SNAPf (Synthetic)
|
Buratowski |
Sep 08, 2022 |
|
|
188940 |
pBS-SKII-URA-GAL1-HALO-GS |
pBS-SKII-URA-GAL1-HALO-GS (Synthetic)
|
Buratowski |
Sep 08, 2022 |
|
|
181895 |
pGFP-nE-mHP1alpha |
nE-mHP1alpha (Mus musculus)
|
Rippe |
Sep 08, 2022 |
|
|
188939 |
pBS-SKII-URA-GAL1-fCLIP-GS |
URA-GAL1-fCLIP-GS (Synthetic)
|
Buratowski |
Sep 08, 2022 |
|
|
188938 |
pBS-SKII-URA-GAL1-fSNAP-GS |
URA-GAL1-fSNAP-GS (Synthetic)
|
Buratowski |
Sep 08, 2022 |
