|
|
139421 |
pPEE42 |
Citrine (Other)
|
Fraser |
Feb 08, 2021 |
|
|
131640 |
GABPA_pet28a |
GABPA (Homo sapiens)
|
Hollenhorst |
Feb 08, 2021 |
|
|
157652 |
GGDestX1-Amp |
|
Haynes |
Feb 08, 2021 |
|
|
163386 |
pLVX-RT006-GCN4-HaloPM |
4XGCN4-Halotag-PDGFRtm-2A-mCherry (GCN4-HaloPM) (Synthetic)
|
Winslow |
Feb 08, 2021 |
|
|
160140 |
pCMV-T7-AsCas12a-P2A-EGFP (RTW2861) |
human codon optimized AsCas12a with NLS(nucleoplasmin)-3xHA-P2A-EGFP (Synthetic)
|
Kleinstiver |
Feb 08, 2021 |
|
|
160139 |
pT7-AsCas12a_crRNA-site4 (MSP3511) |
AsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG) (Synthetic)
|
Kleinstiver |
Feb 08, 2021 |
|
|
160138 |
pT7-AsCas12a_crRNA-site3 (RTW549) |
AsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC) (Synthetic)
|
Kleinstiver |
Feb 08, 2021 |
|
|
160137 |
pT7-SpCas9_sgRNA-site2 (RTW448) |
SpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT) (Synthetic)
|
Kleinstiver |
Feb 08, 2021 |
|
|
160136 |
pT7-SpCas9_sgRNA-site1 (RTW443) |
SpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG) (Synthetic)
|
Kleinstiver |
Feb 08, 2021 |
|
|
160135 |
p11-5’_10xN_PAM-site4 (RTW574) |
Plasmid library harboring a randomized 10nt PAM 5’ of target site 4 (Synthetic)
|
Kleinstiver |
Feb 08, 2021 |
|
|
160134 |
p11-5’_10xN_PAM-site3 (RTW572) |
Plasmid library harboring a randomized 10nt PAM 5’ of target site 3 (Synthetic)
|
Kleinstiver |
Feb 08, 2021 |
|
|
160133 |
p11-3’_8xN_PAM-site2 (RTW555) |
Plasmid library harboring a randomized 8nt PAM 3’ of target site 2 (Synthetic)
|
Kleinstiver |
Feb 08, 2021 |
|
|
160132 |
p11-3’_8xN_PAM-site1 (RTW554) |
Plasmid library harboring a randomized 8nt PAM 3’ of target site 1 (Synthetic)
|
Kleinstiver |
Feb 08, 2021 |
|
|
164907 |
pAAV-U6-pegSERPINA1-U6-Nicking-PE2-N |
pegSERPINA1, Nicking sgRNA, PE2-N
|
Xue |
Feb 08, 2021 |
|
|
164170 |
pAT-mWasabi-G |
mWasabi (Synthetic)
|
Tanida |
Feb 08, 2021 |
|
|
164169 |
pAT-mCherry2-G |
mCherry2 (Synthetic)
|
Tanida |
Feb 08, 2021 |
|
|
164164 |
pCAG-mCherry2-mito |
mCherry2-mtActA (Synthetic)
|
Tanida |
Feb 08, 2021 |
|
|
136534 |
pSLIK Zeo p53DD |
p53DD (Mus musculus)
|
Janes |
Feb 06, 2021 |
|
|
135134 |
SNRPA_Full-length_pGEX |
SNRPA (Homo sapiens)
|
Burge |
Feb 06, 2021 |
|
|
162498 |
GFP-CD8a(7A) |
CD8a with a mutated stem region (Homo sapiens)
|
Lu |
Feb 05, 2021 |
|
|
162519 |
SyGCaMP5G |
GCaMP5G (Rattus norvegicus)
|
Kittler |
Feb 05, 2021 |
|
|
138901 |
pPD290 ZF43x6-Compact_EYFP |
ZF43x6-Compact (Synthetic)
|
Leonard |
Feb 05, 2021 |
|
|
138900 |
pPD289 ZF43x5-Compact_EYFP |
ZF43x5-Compact (Synthetic)
|
Leonard |
Feb 05, 2021 |
|
|
138899 |
pPD288 ZF43x4-Compact_EYFP |
ZF43x4-Compact (Synthetic)
|
Leonard |
Feb 05, 2021 |
|
|
164909 |
pAAV-PE2-N |
PE2-N
|
Xue |
Feb 05, 2021 |
|
|
163786 |
pRRL-MND-hCard11 R30W-T2A-GFP |
CARD11 (Homo sapiens)
|
James |
Feb 05, 2021 |
|
|
163779 |
pRRL-MND-hCard11 K41R-T2A-GFP |
CARD11 (Homo sapiens)
|
James |
Feb 05, 2021 |
|
|
163774 |
pRRL-MND-hCard11 R35Q-T2A-GFP |
CARD11 (Homo sapiens)
|
James |
Feb 05, 2021 |
|
|
164514 |
pAAV.GFAP.(Cyto)iGlucoSnFR.mRuby2 |
(Cyto)iGlucoSnFR-mRuby2 (Mus musculus)
|
Looger |
Feb 05, 2021 |
|
|
163961 |
Human b4 nicotinic receptor subunit EM construct |
Human beta4 nicotinic acetylcholine receptor subunit EM construct (Homo sapiens)
|
Hibbs |
Feb 05, 2021 |
|
|
163960 |
Human a3 nicotinic receptor subunit EM construct |
Human alpha3 nicotinic acetylcholine receptor subunit EM construct (Homo sapiens)
|
Hibbs |
Feb 05, 2021 |
|
|
102839 |
pBW_0007 |
Sr22 PI573523 (Synthetic)
|
Wulff |
Feb 05, 2021 |
|
|
102838 |
pBW_0006 |
Sr22 Schomburgk (Synthetic)
|
Wulff |
Feb 05, 2021 |
|
|
102837 |
pBW_0005 |
Sr22 PI573523 (Synthetic)
|
Wulff |
Feb 05, 2021 |
|
|
102836 |
pBW_0004 |
Sr22 PI190945 (Synthetic)
|
Wulff |
Feb 05, 2021 |
|
|
102835 |
pBW_0003 |
Sr22 Schomburgk (Synthetic)
|
Wulff |
Feb 05, 2021 |
|
|
102834 |
pBW_0002 |
Sr22 Schomburgk (Synthetic)
|
Wulff |
Feb 05, 2021 |
|
|
102833 |
pBW_0001 |
Sr22 Schomburgk (Synthetic)
|
Wulff |
Feb 05, 2021 |
|
|
102820 |
pBW_0141 |
wheat stem rust resistance gene Sr45 (Synthetic)
|
Wulff |
Feb 05, 2021 |
|
|
102819 |
pBW_0059 |
wheat stem rust resistance gene Sr35 (Synthetic)
|
Wulff |
Feb 05, 2021 |
|
|
102817 |
pBW_0065 |
wheat stem rust resistance gene Sr22 (Synthetic)
|
Wulff |
Feb 05, 2021 |
|
|
163829 |
pSYC-437 |
Foxj1a Promoter (Danio rerio), GCaMP6s (Synthetic)
|
Choi |
Feb 05, 2021 |
|
|
138218 |
pcDNA3-ICUE3-NLS |
ICUE3-NLS (Homo sapiens)
|
Zhang |
Feb 05, 2021 |
|
|
133818 |
pFSW Syt1-C2A IRES GFP |
Syt1 (Rattus norvegicus)
|
Chapman |
Feb 05, 2021 |
|
|
161896 |
pDest-311 (attR4-attR3) |
|
Esposito |
Feb 04, 2021 |
|
|
137266 |
thoc5.018.389 |
thoc5 (Homo sapiens)
|
Davis |
Feb 04, 2021 |
|
|
164168 |
pAC-mWasabi-G4 |
mWasabi (Synthetic)
|
Tanida |
Feb 04, 2021 |
|
|
164166 |
pCAG-mCherry2-ER |
mCherry2 (Synthetic)
|
Tanida |
Feb 04, 2021 |
|
|
164165 |
pCAG-mWasabi-ER |
mWasabi (Synthetic)
|
Tanida |
Feb 04, 2021 |
|
|
164163 |
pCAG-mEGFP-HO-G |
mEGFP A236K (Synthetic)
|
Tanida |
Feb 04, 2021 |
