Skip to main content

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
230236 AiP12712 - pAAV-AiE0705m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2712) SYFP2 (Synthetic) Levi Apr 30, 2025
230232 AiP12695 - pAAV-AiE0693h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2695) SYFP2 (Synthetic) Levi Apr 30, 2025
230231 AiP12693 - pAAV-AiE0713h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2693) SYFP2 (Synthetic) Levi Apr 30, 2025
230230 AiP12690 - pAAV-AiE0692h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2690) SYFP2 (Synthetic) Levi Apr 30, 2025
230229 AiP12686 - pAAV-AiE0648h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2686) SYFP2 (Synthetic) Levi Apr 30, 2025
230227 AiP12681 - pAAV-AiE0565h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2681) SYFP2 (Synthetic) Levi Apr 30, 2025
230226 AiP12680 - pAAV-AiE0564h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2680) SYFP2 (Synthetic) Levi Apr 30, 2025
230224 AiP12678 - pAAV-AiE0562h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2678) SYFP2 (Synthetic) Levi Apr 30, 2025
230222 AiP12649 - pAAV-AiE0716h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2649) SYFP2 (Synthetic) Levi Apr 30, 2025
230221 AiP12640 - pAAV-AiE0758m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2640) SYFP2 (Synthetic) Levi Apr 30, 2025
230220 AiP12627 - pAAV-AiE0734m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2627) SYFP2 (Synthetic) Levi Apr 30, 2025
230219 AiP12624 - pAAV-AiE0767m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2624) SYFP2 (Synthetic) Levi Apr 30, 2025
230218 AiP12623 - pAAV-AiE0766m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2623) SYFP2 (Synthetic) Levi Apr 30, 2025
230217 AiP12605 - pAAV-AiE0773m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2605) SYFP2 (Synthetic) Levi Apr 30, 2025
230216 AiP12600 - pAAV-AiE0765m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2600) SYFP2 (Synthetic) Levi Apr 30, 2025
230215 AiP12496 - pAAV-AiE0386h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2496) SYFP2 (Synthetic) Levi Apr 30, 2025
230211 AiP12431 - pAAV-AiE0483m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2431) SYFP2 (Synthetic) Levi Apr 30, 2025
230203 AiP12322 - pAAV-AiE0482m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2322) SYFP2 (Synthetic) Levi Apr 30, 2025
230202 AiP12319 - pAAV-AiE0474m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2319) SYFP2 (Synthetic) Levi Apr 30, 2025
230201 AiP12310 - pAAV-AiE0131h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2310) SYFP2 (Synthetic) Levi Apr 30, 2025
230199 AiP12309 - pAAV-AiE0130h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2309) SYFP2 (Synthetic) Levi Apr 30, 2025
230197 AiP12262 - pAAV-AiE0487m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2262) SYFP2 (Synthetic) Levi Apr 30, 2025
230196 AiP12260 - pAAV-AiE0485m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2260) SYFP2 (Synthetic) Levi Apr 30, 2025
230195 AiP12259 - pAAV-AiE0480m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2259) SYFP2 (Synthetic) Levi Apr 30, 2025
230193 AiP12167 - pAAV-AiE0407h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2167) SYFP2 (Synthetic) Levi Apr 30, 2025
230192 AiP12164 - pAAV-AiE0404h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2164) SYFP2 (Synthetic) Levi Apr 30, 2025
230191 AiP12160 - pAAV-AiE0398h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2160) SYFP2 (Synthetic) Levi Apr 30, 2025
230190 AiP12159 - pAAV-AiE0397h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2159) SYFP2 (Synthetic) Levi Apr 30, 2025
230189 AiP12152 - pAAV-AiE0389h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2152) SYFP2 (Synthetic) Levi Apr 30, 2025
230188 AiP12120 - pAAV-AiE0376m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2120) SYFP2 (Synthetic) Levi Apr 30, 2025
230186 AiP12092 - pAAV-AiE0402m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2092) SYFP2 (Synthetic) Levi Apr 30, 2025
230185 AiP12091 - pAAV-AiE0398m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2091) SYFP2 (Synthetic) Levi Apr 30, 2025
230184 AiP12083 - pAAV-AiE0372m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2083) SYFP2 (Synthetic) Levi Apr 30, 2025
235493 pEGFP-TDP-43 (K408R) TARDBP (Homo sapiens) Rousseaux Apr 30, 2025
235488 pEGFP-TDP-43 (Q331K) TARDBP (Homo sapiens) Rousseaux Apr 30, 2025
235491 pEGFP-TDP-43 (5FL) TARDBP (Homo sapiens) Rousseaux Apr 30, 2025
230639 AiP1390 - pAAV-AiE2161m-minBG-SYFP2-WPRE3-BGHpA SYFP2 (Synthetic) Tasic Apr 30, 2025
235487 pEGFP-TDP-43 TARDBP (Homo sapiens) Rousseaux Apr 30, 2025
235492 pEGFP-TDP-43 (K136R) TARDBP (Homo sapiens) Rousseaux Apr 30, 2025
230623 AiP1327 - pAAV-AiE2068m_3xC2-minBG-SYFP2-WPRE3-BGHpA SYFP2 (Synthetic) Tasic Apr 30, 2025
207583 HaloKu70 sgRNA GAGCAGTAGCCAACATGTCA (Homo sapiens) Schmidt Apr 30, 2025
235496 pDEST-TDP-43-HA TARDBP (Homo sapiens) Rousseaux Apr 30, 2025
207093 DNA-PKcs N-terminal sgRNA AGCGGGACTCGGCGGCATGG (Homo sapiens) Schmidt Apr 30, 2025
235495 pDEST-TDP-43-SUMO2-HA TARDBP (Homo sapiens) Rousseaux Apr 30, 2025
207088 Halo-DNAPKcs HRD HaloTag with internal PuroR cassette flanked by human DNAPKcs locus sequences (Homo sapiens) Schmidt Apr 30, 2025
214429 pLEX_307-SARS-CoV-2-NSP3-V5 SARS-CoV-2 NSP3 (part of SARS-CoV-2 ORF1ab) (Other) Babu Apr 30, 2025
191224 pLD-puro-Cc-IFIT5_K206R-VA interferon-induced protein with tetratricopeptide repeats 5 (Homo sapiens) Babu Apr 30, 2025
191223 pLD-puro-Cc-IFIT5_K197R-VA interferon-induced protein with tetratricopeptide repeats 5 (Homo sapiens) Babu Apr 30, 2025
191222 pLD-puro-Cc-IFIT5_K160R-VA interferon-induced protein with tetratricopeptide repeats 5 (Homo sapiens) Babu Apr 30, 2025
191221 pLD-puro-Cc-IFIT5_WT-VA interferon-induced protein with tetratricopeptide repeats 5 (Homo sapiens) Babu Apr 30, 2025