Skip to main content

Sequence Analyzer: pMS84 (U6p::GGACAGTCCTGCCGAGGTGG) Sequencing Result


The new visualizations may take a few seconds to load. Thank you for your patience as we work to enhance our plasmid and sequence displays.

Status:

Sequence copied!

Sequence View

Sequence copied!

Restriction Enzymes

Instructions: By default, all cutters are shown. Filter on number of cut sites or search by enzyme name.

Filter

Enzyme Cut Site (bp) Total Cuts

Features

Feature Location (bp) Size Color Direction Type

Primers

Primer Name Sequence (5' to 3') Binding Sites (bp) Length (bases) Direction

BLAST

BLAST (Basic Local Alignment Search Tool) finds regions of similarity between biological sequences. Click on the buttons below to submit a BLAST search to NCBI. The results will appear in a new window. See your recent BLAST results on NCBI's website.

Sequence Analyzer Guide

Map

Displays a graphical map based on nucleotide sequence data labeled with restriction enzymes, plasmid features, ORFs (theoretical open reading frames) and primers. Hovering over data labels will display additional information (e.g. cut site)

Sequence

Displays both strands of base paired nucleotide sequences with annotated enzymes, plasmid features, ORFs (theoretical open reading frames) and primers. Hovering over data labels will display additional information (e.g. cut site).

Enzymes

List of restriction enzymes that can cut a given nucleotide sequence. Table lists enzyme name and the sequence location of the cut.

Features

List of common features detected in a given nucleotide sequence. Table lists feature name, location, size, color used to indicate its position on the map, and direction (if relevant).

Primers

List of commonly used primers detected in a given nucleotide sequence. Table lists primer name, sequence, length, binding site location, and direction.

BLAST

Use Basic Local Alignment Search Tool (BLAST) via the NCBI website to determine similarity between a given sequence and nucleotide (BLASTN) or protein (BLASTX) sequence databases. Additionally, align a custom nucleotide sequence against a given sequence using BLAST2.