High-throughput library transgenesis in Caenorhabditis elegans via Transgenic Arrays Resulting in Diversity of Integrated Sequences (TARDIS).
Stevenson ZC, Moerdyk-Schauwecker MJ, Banse SA, Patel DS, Lu H, Phillips PC
Elife. 2023 Jul 4;12:RP84831. doi: 10.7554/eLife.84831. PubMed Article
Stevenson ZC, Moerdyk-Schauwecker MJ, Banse SA, Patel DS, Lu H, Phillips PC
Elife. 2023 Jul 4;12:RP84831. doi: 10.7554/eLife.84831. PubMed Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 193048 | pZCS36 (Phsp16.41::Cas9(dpiRNA)::tbb-2 ‘3UTR) | Heatshock expressed Cas9 |
| 193049 | pZCS38 (Prsp-27::NeoR::unc-54 3’ UTR) | Encodes G-418 resistance |
| 193050 | pZCS41 (U6p::GCGAAGTGACGGTAGACCGT) | Encodes guide RNA expression targeting PX740 landing pad |
| 193852 | pMS84 (U6p::GGACAGTCCTGCCGAGGTGG) | Encodes the guide RNA targeting the sequence GGACAGTCCTGCCGAGGTGG |
| 193853 | pDSP15 (5’Δ HygR + loxP + MCS + 5’Δ mScarlet-I) | Promoterless insertion vector for split HygR/mScarlet-I landing pad |
| 193854 | pDSP16 (5’Δ Cbr-unc-119(+) + loxN + MCS + 5’Δ mNeonGreen) | Promoterless insertion vector for split Cbr-unc-19(+)/mNeonGreen landing pad |