pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
(Plasmid
#193050)
-
PurposeEncodes guide RNA expression targeting PX740 landing pad
-
Depositing Lab
-
Depositing OrganizationUniversity of Oregon
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193050 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepZCS11
-
Backbone manufacturerPhillips Lab
- Backbone size w/o insert (bp) 3233
- Total vector size (bp) 3253
-
Modifications to backboneNone from pZCS11
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGuide RNA
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)20
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caggaaacagctatgaccatg
- 3′ sequencing primer aatctgctctgatgccgcataG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.30.514301v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT) was a gift from Patrick Phillips (Addgene plasmid # 193050 ; http://n2t.net/addgene:193050 ; RRID:Addgene_193050) -
For your References section:
High-throughput library transgenesis in Caenorhabditis elegans via Transgenic Arrays Resulting in Diversity of Integrated Sequences (TARDIS). Stevenson ZC, Moerdyk-Schauwecker MJ, Banse SA, Patel DS, Lu H, Phillips PC. Elife. 2023 Jul 4;12:RP84831. doi: 10.7554/eLife.84831. 10.7554/eLife.84831 PubMed 37401921