pDSP15 (5’Δ HygR + loxP + MCS + 5’Δ mScarlet-I)
(Plasmid #193853)

• Purpose: Promoterless insertion vector for split HygR/mScarlet-I landing pad
• Depositing Lab: Patrick Phillips
• Publication: Stevenson et al Elife. 2023 Jul 4;12:RP84831. doi: 10.7554/eLife.84831.

Backbone

• Vector backbone: pDSP1
• Total vector size (bp): 4168
• Vector type: Worm Expression, Cre/Lox, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 5' rps-0::HygR + 5' mScarlet-I
• Species: Synthetic
• Insert Size (bp): 2098
• Promoter: rps-0p

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGTTGAATACTCAGTCAACG
• 3′ sequencing primer: TAGATCCTTCCATGTGAACC

Resource Information

• Supplemental Documents:
  • pDSP15 (empty vector HygRScarlet).gb
• A portion of this plasmid was derived from a plasmid made by: rps-0p::HygR from pDD282 (acquired from Addgene)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.10.30.514301v1 for bioRxiv preprint.