We narrowed to 3,419 results for: zebrafish
-
Plasmid#254764PurposeVamp8 gRNA for neutrophil specific KO in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only
-
si:ch211-221n23.1_R (OZ604)
Plasmid#35244DepositorInsertZinc finger array targeting si:ch211-221n23.1 (si:ch211-221n23.1 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
zgc:162148_L (OZ579)
Plasmid#35219DepositorInsertZinc finger array targeting zgc:162148 (micu1 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
si:ch211-221n23.1_L (OZ603)
Plasmid#35243DepositorInsertZinc finger array targeting si:ch211-221n23.1 (si:ch211-221n23.1 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-pa-u6ac-Rabep1-1-guides
Plasmid#254761PurposeRabep1 gRNAs for neutrophil specific KO in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
p077 pCS xTRPS1 (M)
Plasmid#11047DepositorInsertTRPS1 mut (trps1 Frog)
UseMammalian, avian, and zebrafishMutationTwo Cys residues in the GATA-type zinc finger wer…Available SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Crestin-zFUCCI-IRES-EGFP-caax (JDW 1516)
Plasmid#242601PurposeA Tol2 expression vector containing the Crestin enhancer driving FUCCI to label cell cycle in neural crest cells followed by an IRES-EGFP-caax to label all neural crest cells green.DepositorInsertmCerulean-zGEM-P2A-mCherry-zCdt1
UseZebrafish expressionPromoterCrestin enhancerAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Fli1-zFUCCI-IRES-mTagBFP2 (JDW 1517)
Plasmid#242602PurposeA Tol2 expression vector containing the fli promoter driving FUCCI to label cell cycle in all blood vessels followed by an IRES-mTagBFP2.DepositorInsertmCerulean-zGem-P2A-mCherry-zCdt1, nls-mTagBFP2
UseZebrafish expressionPromoterfli promoterAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-pa-u6ac-Lats1-guides
Plasmid#254766PurposeLat1 gRNA for neutrophil specific KO in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
p076 pCS xTRPS1 delN delC320 (M)
Plasmid#11046DepositorInsertTRPS1 (trps1 Frog)
UseMammalian, avian, and zebrafishMutationaa806-952 of xTRPS1. Two Cys residues in the GAT…Available SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
p063 pCS xTRPS1 delta N (M)
Plasmid#11036DepositorInsertTRPS1 deltaN mut (trps1 Frog)
UseMammalian, avian, and zebrafishMutationaa806-1153 of xTRPS1. Two Cys residues in the GA…Available SinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-Tev-Akt3 C119S-2X Flag
Plasmid#87608Purposeexpresses halo tagged at the N-terminus and 2 tandem flag tags at the C-terminus of C119S mutant of human Akt3 proteinDepositorInsertAKT3 isoform 2 (AKT3 Human)
UseZebrafish (danio rerio) expressionTags2 tandem flag tags and His-Halo-TevExpressionMammalianMutationcysteine 119 residue mutated to serineAvailable SinceNov. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
p073 pCS xGATA4tr + xTRPS1(C119)
Plasmid#11044DepositorUseXenopus, mammalian, avian, and zebrafishMutationFusion construct of XGATA4 (amino acids 1-274) wi…Available SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
p075 pCS xTRPS1 delN delC119 (M)
Plasmid#11045DepositorInsertTRPS1 delN delC119 mut (trps1 Frog)
UseXenopus, mammalian, avian, and zebrafishMutationaa806-1153 of xTRPS1. Two Cys residues in the GA…Available SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only