We narrowed to 8,955 results for: aav
-
Viral prep#100857-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.Syn.NES-jRGECO1b.WPRE.SV40 (#100857). In addition to the viral particles, you will also receive purified pAAV.Syn.NES-jRGECO1b.WPRE.SV40 plasmid DNA. Syn-driven jRGECO1b calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable sinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAAV asRILpolyGly GFP (OPDM type 4)
Plasmid#250411PurposeGFP-tagged polyglycine protein expressed from the antisense transcript of RILPL1. This vectors uses 100 GGN optimized codons.DepositorInsertasRILpolyGly
UseAAVTagsGFPExpressionMammalianAvailable sinceMarch 16, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV-hSyn-PiGM-Iq(D387A mCherry)
Plasmid#221605PurposeA recombinant AAV2 plasmid encoding the light insensitive PiGM-Iq system with CRY2PHR(D387A), CIBN and mCherry as expression marker. hSynapsin promoter for panneuronal expression.DepositorInsertPiGM-Iq (D387A, mCherry)
UseAAVMutationRGS2 1-53 truncation, CRYPHR D387APromoterHuman SynapsinAvailable sinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-PiGM-Iq(D387A eGFP)
Plasmid#221603PurposeA recombinant AAV2 plasmid encoding the light insensitive PiGM-Iq system with CRY2PHR(D387A), CIBN and EGFP as expression marker. hSynapsin promoter for panneuronal expression.DepositorInsertPiGM-Iq (D387A, eGFP)
UseAAVMutationRGS2 1-53 truncation, CRYPHR D387APromoterHuman SynapsinAvailable sinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-FlpOn-CreOff-MCS-P2A-mCherry
Plasmid#176277PurposeViral vector for co-expression of a CDS of interest and mCherry in cells expressing Flp AND NOT Cre driven by a Synapsin promoter. Contains an in-frame P2A sequence and an MCS for cloning of the CDS.DepositorInsertMCS-P2A-mCherry
UseAAV and Cre/LoxExpressionMammalianPromoterhuman Synapsin IAvailable sinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP13755: pAAV-AiE0743m_3xC2-minBG-ChR2(H134R)-EYFP-WPRE3-BGHpA (Alias: CN3755)
Plasmid#214846PurposeExpression of ChR2(H134R)-EYFP in striatal cholinergic neuronsDepositorHas serviceAAV PHP.eBInsertChR2(H134R)-EYFP
UseAAVAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_EF1a-FLEx(FRT)-GCaMP8m
Plasmid#252530PurposeExpresses the genetically encoded calcium indicator GCaMP8m in Flp-expressing cells under the EF1a promoter for calcium imaging.DepositorInsertGCaMP8m
UseAAVExpressionMammalianAvailable sinceMay 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pM148: pAAV.CMV-Cas13e-NT sgRNA
Plasmid#203446PurposePlasmid expressing active RfxCas13d with non-targeting gRNADepositorInsertsU6-non targeting (NT) sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc CB6PI Gpluc7XmiR-122T
Plasmid#35647DepositorInsert7 bulged miR-122 target sites
UseAAVPromoterCBAvailable sinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-NES-SomaKGECO1
Plasmid#232839PurposeAAV transfer plasmid for Syn-mediated expression of soma-targeted KGECO1DepositorInsertNES-SomaKGECO1
UseAAVTagsnuclear export sequenceExpressionMammalianPromoterSynAvailable sinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-ChR2-YFP
Plasmid#178722PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of ChR2-YFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertChR2-YFP
UseAAVAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-ChR2-YFP
Plasmid#178723PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of ChR2-YFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertChR2-YFP
UseAAVAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-ChR2-YFP
Plasmid#178724PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6-ChR2-YFP
Plasmid#178726PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-V5-APEX2-NES
Plasmid#178700PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-V5-APEX2-NES
Plasmid#178704PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of V5-APEX2-NES in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertV5-APEX2-NES
UseAAVAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-V5-APEX2-NES
Plasmid#178698PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-V5-APEX2-NES
Plasmid#178699PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV 9P31-hSyn-Venus-P2A-Tau-RING I18R/M72E
Plasmid#233694PurposeAAV expression of Venus-P2A-Tau-RING-I18R/M72E from hSyn promoterDepositorInsertVenus-P2A-Tau-RING I18R-M72E
UseAAVExpressionMammalianAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only