We narrowed to 18,120 results for: multi
-
Plasmid#164125Purposep15A backbone with PhlF binding sitesDepositorInsertsfGFP
ExpressionBacterialPromoterJ23105Available SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDSG320
Plasmid#115597Purposesurface-displayed Nb2, used in composability experiments; medium copyDepositorInsertregulated adhesin construct
ExpressionBacterialAvailable SinceOct. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTuLys2CMR2
Plasmid#53544PurposeInhibition module. Constructed from the parent plasmids pLuxRI, pLuxmCherry, pET15bLCFPT7, and pLysS. The plasmid can express T7 lysozyme by inducing AHL and LuxR. Chloramphenicol resistanceDepositorInsertpLux
UseUnspecifiedAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPROBE'-gfp[LVA]
Plasmid#40171DepositorInsertPromotor probe
Available SinceDec. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMOS018: ratiometric pHluorin (mitchondrial)
Plasmid#163053Purposeratiometric pHluorin (mitchondrial)DepositorInsertratiometric pHluorin
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ142-ZmUbi-tRNA
Plasmid#158578PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 and pYPQ132-tRNA2.0; assembly of 2 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ143-ZmUbi-tRNA
Plasmid#158400PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ133-tRNA2.0; assembly of 3 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ144-ZmUbi-tRNA
Plasmid#158402PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ134-tRNA2.0; assembly of 4 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
G-GECO1-Orai1
Plasmid#73561PurposeGreen fluorescent reporter of Orai1-associated calcium influxDepositorInsertNM_032790.3 (ORAI1 Synthetic, Human)
TagsG-GECO1ExpressionMammalianPromoterCMV Immediate EarlyAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdx1-mTQ2-P2A-FlpO-PA
Plasmid#67279PurposePancreas specific expression of the FlpO recombinase controlled by the pdx1 promoter . FlpO is linked to mTQ2 -a blue fluorescent protein. The gene cassette is in a SB transposon contextDepositorInsertsmTQ2=mturquoise2 blue fluorescent gene
FlpO recombinase
Tagslinked to FlpO through an P2A ribosomal skipping …ExpressionMammalianPromoterpdxAvailable SinceJuly 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
dCas9v2
Plasmid#103140PurposeTetR inducible dCas9-VPR plasmid with pRPR-NotI-tRPR1 Csy4-ready siteDepositorInsertdCas9-VPR
ExpressionYeastMutationRemoved scaffold gRNA from original plasmidAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
LoxP1-His-H2B-Cherry-2A (SO290)
Plasmid#99616PurposeTo clone gene of interest downstream of LoxP1-His-H2B-Cherry-2A cassetteDepositorInsert6xHis-H2B-Cherry
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Halo-VSVG-RUSH
Plasmid#166907PurposeRUSH cargo: Str-Ii_IRES_VSVG-SBP-HaloDepositorInsertHaloTag
TagsHaloTagExpressionMammalianAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131-STU-Lb
Plasmid#138096PurposeGolden Gate entry vector for 1st crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMSGV-mCD105scFv-myc-CD28HTMcostim-T2A-Thy1.1
Plasmid#193942Purposea fully murine CAR targeting CD105 (endoglin), a component of the TGFβ receptor expressed on the surface of certain solid tumors and acute leukemias.DepositorInsertheavy- and light-chain regions of the MJ7/18 hybridoma and constructed a single chain variable fragment (scFv)
UseRetroviralAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnCS_SEPT7_SEPT9_i1-TEV-Strep
Plasmid#174500Purposebacterial co-expression of human SEPT7 and of human SEPT9_i1DepositorAvailable SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FoxJ1 promoter-IRES-EGFP-Flag-hChibby1
Plasmid#122964PurposeExpresses Flag-tagged Chibby1 in multiciliated cells under FoxJ1 promoter. It can be used as a cloning vector for gene of interest at SfiI sites.DepositorAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIRES_IBB-mCherry-IRES-HA-mAID-nanobody
Plasmid#117720PurposeExpression of nuclear transfection marker IBB-mCherry and HA-tagged mAID-nanobody from one mRNADepositorInsertsmAID-nanobody
IBB-mCherry
Tagsimportin-beta bining domain (IBB) and triple HAExpressionMammalianMutationcodon optimized mAID for murine expressionPromoterCMV and None, IRES-drivenAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only