We narrowed to 16,712 results for: grna
-
Plasmid#73797Purposeoptimized lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pEM047 [T7-assisted CROPseq sgRNA expression vector]
Plasmid#224899PurposeLentiviral CROP-seq vector with lineage barcode cassette and T7 promoter for ID amplification from cDNADepositorInsertseGFP
LacZ fragment (removed by digestion with BstXI/BlpI for sgRNA cloning)
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
B52 (empty plasmid backbone to express 2 sgRNAs)
Plasmid#100708PurposeEmpty plasmid backbone to express 2 sgRNAs (use BbsI and BsmBI for cloning)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1
Plasmid#233078PurposeExpression vector for sgRNA-S1b and eCas12f1DepositorInsertU6-sgRNA-S1b (BsaI)-CBh-bpNLS-eCas12f1-2xFLAG-P2A-EGFP
UseCRISPRTags2xFLAGExpressionMammalianPromoterhU6, CBhAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKL038 Lenti U6 dCas12a gRNA Puro mCherry
Plasmid#195546PurposedCas12a gRNA expression backboneDepositorInsertLenti U6- empty cassette_Direct repeat_puro_mcherry
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-RNF2-tevopreQ1-epegRNA+5G>T_EF1a-puroR
Plasmid#207355PurposeLentiviral transfer plasmid encoding hU6-driven expression of a RNF2 engineered prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.DepositorInsertRNF2 + 5G>T tevopreq1-prime editing guide RNA (epegRNA)
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA Ef1alpha Puro-T2A-GFP
Plasmid#111596PurposesgRNA Ef1alpha Puro-T2A-GFPDepositorInsertmU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaKKHABE8e-bGH-U6-sgRNA-BsmBI
Plasmid#189923PurposeAAV genome encoding SaKKHABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e V106W
UseAAVMutationnSaCas9 KKH, TadA ABE8e V106WPromoterEFSAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-gRNA-UbC-DsRed-P2A-Bsr
Plasmid#83919PurposeLentiviral SpCas9-gRNA expression vector with DsRed-Express2-P2A-BlastRDepositorInsertsDsRed-Express2
Bsr
UseCRISPR and LentiviralTagsP2APromoterhUbCAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTol2-hsp70l:Cas9-t2A-GFP, 5xU6:sgRNA
Plasmid#108871PurposeExpression of heat shock inducible Cas9-GFP and U6-driven 5 individual gRNAs for scGESTALT in zebrafishDepositorInserts5xU6:sgRNA
Cas9-t2A-GFP
UseCRISPRPromoterU6 and hsp70Available SinceApril 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX601 miniCMV-SaCas9-SpA-sgRNA scaffold
Plasmid#107055PurposeBackbone vector for cloning in target sgRNA for use with SaCas9 (SauCas9)DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti_sgRNA(MS2)_MCP-VP64-IRES-zsGreen1
Plasmid#138461Purposelenti sgRNA cloning backbone with MS2 loops and EF1a-MCP-VP64DepositorInsertMCP-VP64-IRES-zsGreen1
UseCRISPR and LentiviralExpressionMammalianPromoterEF1AAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXR004: CasRx pre-gRNA cloning backbone
Plasmid#109054PurposehU6-driven expression of guide RNAs compatible with CasRx. Contains BbsI sites for guide cloning flanked by 5' and 3' full-length DRsDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterhU6Available SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP64-pU6-sgRNA
Plasmid#158972PurposeVector C encodes pAAV-pMecp2-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti_sgRNA(MS2)_MCP-KRAB-IRES-zsGreen1
Plasmid#138460Purposelenti sgRNA cloning backbone with MS2 loops and EF1a-MCP-KRABDepositorInsertMCP-KRAB-IRES-zsGreen1
UseCRISPR and LentiviralExpressionMammalianPromoterEF1AAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-dSaCas9-VP64-pU6-sgRNA
Plasmid#158990PurposeVector G encodes pAAV-pCMV-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in mammalian cellsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpCMVAvailable SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
Plasmid#115694PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.DepositorInsertsNmeCas9
Nme-sgRNA
UseCRISPRTagsNLS and NLS, HAExpressionInsect and MammalianMutationNone and fusion of repeat/tracrRNA to make a sgRNAPromoterEF-1 alpha and U6Available SinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV Jph3gRNA mEmerald hSyn mTagBFP2-CAAX2
Plasmid#236246PurposeEndogenous tagging of Junctophilin 3 with mEmerald with a fluorescent marker for the plasma membraneDepositorInsertgRNA for rat Jph3, mEmerald donor and mTagBFP2-CAAX2
UseAAVTagsmTagBFP2PromoterU6 and human Synapsin1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only