We narrowed to 15,934 results for: jun
-
Plasmid#202289PurposeRPU integration plasmid (LPattB2)DepositorInsertJ23101-RiboJ00-B0034-YFP
ExpressionBacterialAvailable sinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBstSK+IRES-V5-IPpoI (mutant)
Plasmid#206322PurposeA plasmid that facilitates production of mRNA encoding V5 epitope tagged catalytically dead I-PpoIDepositorInsertIRES element-V5 epitope tag-mutated IPpoI open reading frame
UseMrna productionTagsV5-IPpoI fusion protein (mutant version)Available sinceAug. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-YPet-WPRE
Plasmid#193342PurposeAAV-mediated expression of YPet under the TRE promoter in mammalian cellsDepositorInsertYPet
UseAAVExpressionMammalianPromoterTREAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-mNeonGreen-WPRE
Plasmid#193341PurposeAAV-mediated expression of mNeonGreen under the TRE promoter in mammalian cellsDepositorInsertmNeonGreen
UseAAVExpressionMammalianPromoterTREAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-tTA
Plasmid#193338PurposeAAV-mediated expression of tTA under the CAG promoter in mammalian cellsDepositorInserttTA2
UseAAVExpressionMammalianPromoterCAGAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-mRuby3-2A-dCre
Plasmid#203845PurposeFlp-dependent enzymatically inactive Cre and mRuby3 expressionDepositorInsertdCre
UseAAVTagsmRuby3-2AMutationEnzymatically inactive CreAvailable sinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T_PV1_VP1
Plasmid#202071PurposeBacterial expression of VP1 protein from poliovirus 1 (PV1). Contains N-terminal GST-tag and C-terminal His6-tag.DepositorInsertPV1 VP1 protein with Histag
Tags6xHis-tag and GSTExpressionBacterialPromotertacAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-sCAG-GluClβ.CreON
Plasmid#196996PurposeCre recombinase dependent expression of GluClv2.0 beta subunit. GluClβ contains a YFP tag. When co-expressed with GluClv2.0 alpha subunit, agonist (Ivermectin) induces neuronal silencing.DepositorInsertGluClβ -YFP
UseAAV and Cre/LoxTagsYFPPromotershort CAGAvailable sinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
U6-Slc1a3 sgRNA; EF1a-dCas9-KRAB-GFP
Plasmid#194283PurposeEF1a-dCas9-KRAB-GFP with Slc1a3 sgRNADepositorInsertdCas9-KRAB-GFP
UseCRISPR and LentiviralTagsGFPPromoterEF1aAvailable sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
SPDK3860
Plasmid#199245PurposeModified Tobacco rattle virus (TRV) RNA2 vector for editing of Nicotiana benthamiana Phytoene desaturase (PDS) geneDepositorInsertModified TRV RNA2 with PEBV promoter and AtIleu-tRNA mobile RNA sequence
UseT-dna vectorPromoterpPEBVAvailable sinceJune 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLNHA-C1-HsGIGYF2_AE
Plasmid#148550PurposeMammalian Expression of HsGIGYF2DepositorInsertHsGIGYF2 (GIGYF2 Human)
ExpressionMammalianMutationone silent mutation and one deletion of Q1211 com…Available sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187945PurposedCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertSpdCas9-tagRFPt-P2A-tagBFP
UseSynthetic Biology; PiggybacTagsNLS, NLS + HA-tag, P2A, tagBFP, and tagRFPtExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601‐MHP1‐miniABEmaxNG‐N2‐(GG)
Plasmid#187067PurposeGp41-1 Split N-terminal half of ABEmaxNGA driven by MHP1 promoter with gRNA targeting mdx4cv nonsense mutationDepositorInsertminiABEmaxNG-Gp41
UseAAV and CRISPRExpressionMammalianPromoterMHP1Available sinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601‐MHP1‐ABEmaxC2‐NG‐E53 ogRNA
Plasmid#187068PurposeGp41-1 Split C-terminal half of ABEmaxNGA driven by MHP1 promoter with gRNA targeting mdx4cv nonsense mutationDepositorInsertGp41-ABEmaxC2‐NG
UseAAVExpressionMammalianPromoterMHP1Available sinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hPGK-mCherry-SynaptoZip
Plasmid#177317PurposeLentiviral expression of the synaptic activity-marker SynaptoZip fused to mCherry driven by hPGK promoterDepositorAvailable sinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFRT-DHX36iso2E335A
Plasmid#159588PurposeExpress N-ter FLAG HA tagged DHX36 isoform 2 with E335A mutation in mammalian cellsDepositorAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lyn-tdnano-HA
Plasmid#136512PurposeMammalian expression of a tandem dimer of WT SspB (nano), targeted to membrane by Lyn myristoylation sequence, with triple-HA epitope tagDepositorInsertLyn nano nano 3HA
ExpressionMammalianPromoterCMVAvailable sinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH015_AAVS1_puro-pA-core-9xTetO-pEF-H2B-mCitrine-core-pRSV-H2B-mCherry
Plasmid#179437PurposeDual fluorescent reporter construct with double core HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, arms for integration at AAVS1 locusDepositorInsertcoreHS4-TRE-cit-coreHS4-mch (DC)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable sinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH012_AAVS1_puro-pA-9xTetO-pEF-H2B-mCitrine-core-pRSV-H2B-mCherry
Plasmid#179435PurposeDual fluorescent reporter construct with single core HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, arms for integration at AAVS1 locusDepositorInsertTRE-cit-coreHS4-mch (SC)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable sinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only