We narrowed to 17,559 results for: puromycin
-
Plasmid#170577PurposeGateway destination clone of CAMKK2 (human) tagged with N-terminal miniTurbo-V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertminiTurbo-V5-CAMKK2 (CAMKK2 Human)
UseLentiviral; Gateway destinationTagsminiTurbo-V5ExpressionMammalianPromoterUbiquitinAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV LDTS-LIRmut
Plasmid#189001Purposelipophagy-inducing adaptor protein, negative controlDepositorInsertLDTS-LIRmut
UseRetroviralTagsHAAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiGuide_GFP_NT135
Plasmid#183118PurposepLentiGuide modified to express GFP and a non-targeting sgRNADepositorInsertNT135
UseLentiviralPromoterU6Available SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB_TRE_AP4-PDGFR_EF1a_eBFP2
Plasmid#186306PurposePlasmid for inducible mammalian cell expression of the AP4 helixCAM and constitutive expression of an identifying fluorescent protein (eBFP2). Flanked with PiggyBac sites for easy line construction.DepositorInsertsAP4-PDGFR
eBFP2
TagsHA, mycExpressionMammalianAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Hira KO sgRNA
Plasmid#186938PurposeHira KO in mouse ES cellsDepositorAvailable SinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ki67 (8 repeats+LR)-mNeonGreen-IRESpuro2
Plasmid#183741PurposeExpresses Ki67 (8 repeats+LR)-mNeonGreenDepositorInsertMKI67 LR domain + 8 Ki-67 repeats (MKI67 Human)
TagsmNeonGreenExpressionBacterial and MammalianMutationMKI67 LR domain + 8 Ki-67 repeatsPromoterCMVAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shIAPEz_2
Plasmid#185017PurposeshRNA mediated knockdownDepositorInsertERV_IAPEz
UseLentiviralAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP GFP-MOSPD2 RD/LD
Plasmid#186468PurposeExpression of human MOSPD2 (mutant R404D/L406D, unable to bind FFAT motifs) fused to EGFP in mammalian cellsDepositorInsertMOSPD2 motile sperm domain containing 2 (MOSPD2 Human)
UseRetroviralTagsEGFPExpressionMammalianMutationR404D/L406D (mutant unable to bind FFAT motifs)Available SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV:Flag-OgNLuc_SV40:PuroR
Plasmid#183038PurposeExpresses the FLAG-tagged OgNLuc (Orange LumiFluor) in mammalian cells.DepositorInsertOgNLuc LumiFluor
UseLentiviralTagsFLAGExpressionMammalianPromoterCMVAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMX-53BP1(1-1710) 3LA
Plasmid#185698PurposeMammalian Expression, Retroviral vector that encodes a 3LA mutant of 53BP1 that disrupts three RIF1-binding motifs and abolishes the 53BP1-dependent recruitment of RIF1 to DNA double-strand breaks.DepositorInsert53BP1(1-1710) 3LA (TP53BP1 Human)
UseRetroviralTagsFlag tag, HA tag, and tetracysteine tagExpressionMammalianMutationL175A, L517A, and L693APromoterSV40Available SinceJuly 7, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
SETD2(SET)-Cas9
Plasmid#186700PurposePlasmid encoding SETD2-Cas9 fusion under CMV promoterDepositorInsertSETD2(SET)-Cas9
UseCRISPRTagsFLAGExpressionMammalianPromoterCMVAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMX-53BP1(1-1710) 3LA7A
Plasmid#185707PurposeMammalian Expression, Retroviral vector that encodes 7A and 3LA mutant of 53BP1. Prevents shieldin and RIF1 recruitment to sites of double-strand breaks and disrupts 53BP1 activity.DepositorInsert53BP1(1-1710) 3LA7A (TP53BP1 Human)
UseRetroviralTagsFlag tag, HA tag, and tetracysteine tagExpressionMammalianMutationT302A, S452A, S523A, S543A, S625A, S784A, and S89…PromoterSV40Available SinceJuly 1, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
plentiCRISPv2_FDX1-2
Plasmid#184489PurposeLentivirus all in one CRISPR vector targeting human FDX1 geneDepositorInsertFDX1 (FDX1 Human)
UseLentiviralAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-Lenti-TetOn
Plasmid#183555PurposepKDR compatible TetOn lentiviral transfer plasmidDepositorTypeEmpty backboneUseLentiviralAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shIAPEz_1
Plasmid#185016PurposeshRNA mediated knockdownDepositorInsertERV_IAPEz
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEH_AAV_TERT_prom_C7C_1.8kb
Plasmid#183079PurposerAAV transfer plasmid with ITRs flanking: (1) TERT wildtype promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms, and (2) PGK-Puro.DepositorInsertTERT wildtype promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms (TERT Human)
UseAAV; Homologous recombination donor templateMutationWildtype promoter, Exon 1 C7C (C21>T21) silent…PromoterNone for primary insert (Though partial TERT prom…Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro Xlone SOX17
Plasmid#179838PurposeDoxycycline-inducible expression of human SOX17DepositorInsertSOX17 (SOX17 Human)
UseAAV, CRISPR, Synthetic Biology, and TALEN ; Donor…ExpressionMammalianPromoterTRE3GSAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 KBTBD4 P311PP
Plasmid#184625PurposeDoxycycline inducible lentiviral vector for N-terminal Flag tagged KBTBD4 P311PP expression in mammalian cellsDepositorInsertN-terminal Flag tagged KBTBD4 P311PP (KBTBD4 Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianMutationP311PPPromoterTRE promoter, Tet ONAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459-APP-KO
Plasmid#176487PurposeTo knockout APP geneDepositorInsertgRNA sequence
UseCRISPRAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only