We narrowed to 16,105 results for: grna
-
Plasmid#166867PurposeU6-driven expression of control (non-targeting) presgRNA compatible with CasRx.DepositorInsertnon-targeting presgRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
zCREST3:Cas9green; T3_gRNA
Plasmid#199335PurposepDEL161; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type III sgRNADepositorInsertszCREST3
Cas9
nrg1 type III sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; EGF_gRNA
Plasmid#199333PurposepDEL158; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 EGF sgRNADepositorInsertszCREST3
Cas9
nrg1 EGF sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA pAS single_hspCas9
Plasmid#193311PurposeCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-MS2
Plasmid#184839PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the MS2 phage genome and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the MS2 phage genome, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable sinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCJH031_proD_LbCas12a-gRNA-GFP_CAM
Plasmid#183075PurposePlasmid expressing Cas12a guide RNA targeting GFP (1) for in vivo interference assay in bacteria.DepositorInsertLbCas12a guide RNA targeting GFP
UseCRISPRExpressionBacterialAvailable sinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS2_DF_A4b_attP_fwd
Plasmid#182149PurposeTo insert attP-fwd attachment site at IDS2 in human cells via twinPEDepositorInsertIDS2-A4b-attP-fwd pegRNA
ExpressionMammalianPromoterhU6Available sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS_DF_D1b_attB_rev
Plasmid#182152PurposeTo insert attB-rev attachment site at IDS in human cells via twinPEDepositorInsertIDS-D1b-attB-rev pegRNA
ExpressionMammalianPromoterhU6Available sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS_DF_C2c_attB_rev
Plasmid#182151PurposeTo insert attB-rev attachment site at IDS in human cells via twinPEDepositorInsertIDS-C2c-attBrev pegRNA
ExpressionMammalianPromoterhU6Available sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS2_DF_B7b_attP_fwd
Plasmid#182150PurposeTo install attP-fwd attachment site at IDS2 in human cells via twinPEDepositorInsertIDS2-B7b-attP-fwd pegRNA
ExpressionMammalianPromoterhU6Available sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
px330 MAU2 gRNA
Plasmid#165589PurposeInsertion of MAU2 degronDepositorAvailable sinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330 CTCF gRNA
Plasmid#165588PurposeInsertion of CTCF degonDepositorAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330 CBP gRNA
Plasmid#165587Purposeinsertin of CBP degromDepositorAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA7-1
Plasmid#248530PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA7-1
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA7-3
Plasmid#248531PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA7-3
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA8-2
Plasmid#248532PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA8-2
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PGAM1_sgRNA1
Plasmid#201614PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPGAM1 (PGAM1 Human)
UseCRISPR and LentiviralAvailable sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UPP1_sgRNA2
Plasmid#201635PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUPP1 (UPP1 Human)
UseCRISPR and LentiviralAvailable sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA1
Plasmid#201590PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralAvailable sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only