We narrowed to 28,354 results for: cmv promoter
-
Plasmid#176087PurposeEGFP fused to the N-terminus of POLB containing the mutation Lys72Ala, a mutation in the PAM site used by POLBKOg1 & a hygromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsEGFPExpressionMammalianMutationMutation in Lys72 to Ala, and mutation in the PAM…PromoterCMVAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-SMCHD1-Exon1-10A.12D-48-3xFLAG
Plasmid#130678PurposeExpresses human SMCHD1 Exon1-10A.12D-48 with a C-terminal 3xFLAG tagDepositorInsertSMCHD1 Exon1-10A.12D-48 (SMCHD1 Human)
Tags3xFLAGExpressionMammalianMutationD409_F489delPromoterCMVAvailable SinceJune 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1(T114A/F115A)-NLS(SV40) (KAC688)
Plasmid#133798PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA1(T114A/F115A) with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA1(T114A/F115A)
TagsNLS(SV40)ExpressionMammalianMutationT114A/F115APromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO CMV-cGFP-SV40 pA + Laccase2 Exon 2
Plasmid#91802PurposeExpresses the Laccase2 circular RNA when the upstream SV40 poly(A) signal fails to be usedDepositorInsertCoral Green Fluorescent Protein (cGFP)
ExpressionMammalianPromoterCMVAvailable SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-3xHA-SMCHD1-Exon1-14.47M-48-3xFLAG
Plasmid#130691PurposeExpresses human SMCHD1Exon1-14.47M-48 with an N-terminal 3xHA tag and a C-terminal 3xFLAG tagDepositorInsertSMCHD1 Exon1-14.47M-48 (SMCHD1 Human)
Tags3xFLAG and 3xHAExpressionMammalianMutationE653_G1960delPromoterCMVAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-SMCHD1-Exon37-41S.44R-48-3xFLAG
Plasmid#130690PurposeExpresses human SMCHD1 Exon37-41S.44R-48 with a C-terminal 3xFLAG tagDepositorInsertSMCHD1 Exon37-41S.44R-48 (SMCHD1 Human)
Tags3xFLAGExpressionMammalianMutation1M_T1522delinsM, G1720_Y1846delPromoterCMVAvailable SinceSept. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
PHAGE-P CMVt N-HA hE6AP III (C41A, C46A, C840A)
Plasmid#119318Purposelentiviral vector for expression of HA-Tagged E6-AP III (C41A, C46A, C840A) in mammalian cellsDepositorAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZIP-hCMV-ZsGreen-P2A-Puro-IKZF1 sh1
Plasmid#123324PurposeLentiviral vector for expression of shRNA targeting IKZF1 from a miR30 embedded casette in the 3'UTR of ZsGreen-P2A-Puro insertDepositorInsertshRNA targeting IKZF1 embedded in miR30 backbone (IKZF1 Human)
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZIP-hCMV-ZsGreen-P2A-Puro-IKZF3 sh1
Plasmid#123326PurposeLentiviral vector for expression of shRNA targeting IKZF3 from a miR30 embedded casette in the 3'UTR of ZsGreen-P2A-Puro insertDepositorInsertshRNA targeting IKZF3 embedded in miR30 backbone (IKZF3 Human)
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZIP-hCMV-ZsGreen-P2A-Puro-IKZF1 sh2
Plasmid#123325PurposeLentiviral vector for expression of shRNA targeting IKZF1 from a miR30 embedded casette in the 3'UTR of ZsGreen-P2A-Puro insertDepositorInsertshRNA targeting IKZF1 embedded in miR30 backbone (IKZF1 Human)
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZIP-hCMV-ZSGreen-P2A-Puro-IKZF3 sh2
Plasmid#123327PurposeLentiviral vector for expression of shRNA targeting IKZF3 from a miR30 embedded casette in the 3'UTR of ZsGreen-P2A-Puro insertDepositorInsertshRNA targeting IKZF3 embedded in miR30 backbone (IKZF3 Human)
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-Rem2 S69A/S241A/S308A/S334A
Plasmid#51594Purposeexpresses RNAiR myc-tagged Rem2 S-A mutantDepositorInsertRem2 (Rem2 Mouse)
TagsmycExpressionMammalianMutationSerines 69, 241, 308, 334 to Alanines; also RNAi …PromoterCMVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSF4 TetCMV ATF4(5'UTR)-SunTag-Renilla-FKBP-Stop-24xMS2v5-CTE-polyA
Plasmid#164615PurposeExpresses ATF4(5'UTR)-SunTag-Renilla mRNA reporter under tetracycline-inducible promoter. SunTag and Renilla luciferase are in frame with the main start codon of ATF4.DepositorInsertRenilla luciferase
Tags24xMS2v5 (3'UTR) and SunTagExpressionBacterial and MammalianPromoterTetCMVAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
LV-pCMV-FLPo-pGK-mCl-GP33/66
Plasmid#216481PurposeExpresses FLPo and mClover3 fluorescent protein with LMCV GP33-43 and GP66-77 epitopes embedded in loop of mclover to initiate immunogenic tumor cells in KPFrt miceDepositorInsertsFLPo Recombinase
mClover3-GP33/66
UseLentiviralPromoterpCMV and pGKAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
Unfused click editor construct; PCV2-ePhi29 fusion - pCMV-T7-PCV2-ePhi29 (JO1420)
Plasmid#217805PurposeUnfused click editor construct expressing PCV2-ePhi29(D169A), expressed from CMV or T7 promoters.DepositorInsertPCV2-linker-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationPhi29(D169A/M8R/V51A/M97T/G197D/E221K/Q497P/K512E…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 MYC-Smurf2 (FF29/30A, Y459A) WT
Plasmid#24606DepositorAvailable SinceMay 5, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX551-miniCMV-SpCas9D10A nickase
Plasmid#216735PurposeExpresses SpCas9-D10A nickase from a miniCMV promoter. For AAV packaging. Derived from pX551-miniCMV-SpCas9, which was a gift from Alex Hewitt (Addgene #107031)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterT7 and mini-CMVAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV sgRNA Expression Plasmid
Plasmid#174540PurposeContains restriction sites to clone in U6 promoter and sgRNA oligo. CMV-driven mCherry fluorescent marker.DepositorTypeEmpty backboneUseAAVTagsNoneExpressionMammalianPromoterCMVAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV10-VPS13C-M392A W393D W395K I398D-GFP-3xFLAG
Plasmid#248323PurposeMammalian expression of VPS13C mutant for in vitro studiesDepositorInsertVPS13C (VPS13C Human)
TagsGFP-3xFLAGExpressionMammalianMutationM392A, W393D, W395K, I398DPromoterCMVAvailable SinceJuly 10, 2026AvailabilityAcademic Institutions and Nonprofits only