Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pcDNA3.1-CMV-LMO2 (GLuc-VChR1-EYFP)
(Plasmid #72889)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72889 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 6229
  • Total vector size (bp) 8541
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Gaussia luciferase
  • Alt name
    GLuc
  • Species
    Gaussia princeps
  • Insert Size (bp)
    555
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer atgggagtcaaagttctgtt
  • 3′ sequencing primer ccacactggactagtgggtc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Volvox channelrhodopsin 1
  • Alt name
    VChr1

Gene/Insert 3

  • Gene/Insert name
    Enhanced Yellow Fluorescent Protein
  • Alt name
    EYFP

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-CMV-LMO2 (GLuc-VChR1-EYFP) was a gift from Ute Hochgeschwender (Addgene plasmid # 72889 ; http://n2t.net/addgene:72889 ; RRID:Addgene_72889)
  • For your References section:

    Light-emitting channelrhodopsins for combined optogenetic and chemical-genetic control of neurons. Berglund K, Birkner E, Augustine GJ, Hochgeschwender U. PLoS One. 2013;8(3):e59759. doi: 10.1371/journal.pone.0059759. Epub 2013 Mar 27. PONE-D-12-38868 [pii] PubMed 23544095