We narrowed to 14,587 results for: Cas9
-
Plasmid#137886PurposeiSTU-CRISPR/Cas9 with StIV2 intron, NU structure backboneDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pGEL079
Plasmid#137888PurposeiSTU-CRISPR/Cas9 with StIV2 intron, RZ structure backboneDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEL078
Plasmid#137887PurposeiSTU-CRISPR/Cas9 with StIV2 intron, tRNA structure backboneDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCZGY2750
Plasmid#135094PurposeSite specific CRISPR/Cas9 editing of C. elegans Chr IVDepositorInsertsgRNA for cxTi10082 (actgttggatgcctgtgtag)
UseCRISPRExpressionWormPromoterU6Available SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0009
Plasmid#117545PurposeLevel 1 Golden Gate Cassette: Cas9-K855A expression cassette for dicotyledonous plantsDepositorInsert2x35S+5'UTR OMEGA (pICH51288) + SpCas9-KA (no stop codon)(pEPOR0SP0015) + YFP (pICSL50005)+ Nos (pICH41421)
ExpressionPlantPromoter2x35S+5'UTR OMEGA (pICH51288)Available SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0008
Plasmid#117544PurposeLevel 1 Golden Gate Cassette: Cas9-DE expression cassette for dicotyledonous plantsDepositorInsert2x35S+5'UTR OMEGA (pICH51288) + SpCas9-DE (no stop codon)(pEPOR0SP0001) + YFP (pICSL50005)+ Nos (pICH41421)
ExpressionPlantPromoter2x35S+5'UTR OMEGA (pICH51288)Available SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0002
Plasmid#117543PurposeLevel 1 Golden Gate Cassette: Cas9 expression cassette for dicotyledonous plantsDepositorInsert2x35S+5'UTR OMEGA (pICH51288) + SpCas9-p (no stop codon)(pEPOR0SP0009) + YFP (pICSL50005)+ Nos (pICH41421)
ExpressionPlantPromoter2x35S+5'UTR OMEGA (pICH51288)Available SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF511_1
Plasmid#104044PurposeEncodes gRNA for 3' target of human ZNF511 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF511_2
Plasmid#104045PurposeEncodes gRNA for 3' target of human ZNF511 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
px330-MRPsg3
Plasmid#87191Purposedisruption of human RMRP gene via CRISPR-Cas9, guide 3DepositorAvailable SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C16orf80 sgRNA 1
Plasmid#70651PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C16orf80 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C16orf80
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C16orf80 sgRNA 2
Plasmid#70650PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C16orf80 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C16orf80
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C3orf17 sgRNA 2
Plasmid#70653PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C3orf17 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C3orf17
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJK430
Plasmid#155377PurposePphlF_A2NT in dCRv1, 2x cascade + [dCas9 + PA4-mVenus]DepositorInsertsdCas9 (bacteria)
PA4-mVenus
PphlF_A2NT in dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMK290 (mAID-mClover-Hygro)
Plasmid#72828PurposeC-terminal tagging with mAID-mClover using CRISPR/Cas9DepositorInsertmAID-mClover-Hygro
UseCRISPRTagsmAID-mCloverExpressionMammalianAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEM-HaloTag-UBF
Plasmid#247351PurposeCRISPR/Cas9 donor plasmid to tag human UBF with Halo tagDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
ePPE
Plasmid#183095PurposeFor plant prime editing in rice plants or monocotyledons protoplastsDepositorInsertNls-nCas9-NC-nls-MLV-Nls
UseCRISPRExpressionPlantMutationD10A in SpCas9Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
ePPE-spG
Plasmid#183096PurposeFor plant prime editing in rice plants or monocotyledons protoplastsDepositorInsertNls-nspGCas9-NC-nls-MLV-Nls
UseCRISPRExpressionPlantMutationD10A in SpGCas9Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
7a sgRNA for EJ7-GFP and 4-μHOM reporters
Plasmid#113620PurposesgRNA/CAS9 expression plasmid to induce the 5’ double-strand break in both the EJ7-GFP and 4-μHOM reportersDepositorInsert7a sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only