171,685 results
-
Plasmid#87078PurposeLentiviral Gateway-compatible expression vector backbone with an N-terminal Nanoluc luciferaseDepositorTypeEmpty backboneUseLentiviralTagsNanoluc luciferaseExpressionMammalianAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only
-
PNCA-luciferase
Plasmid#67793PurposeUse together with pCMV-intron and VSV-G to package MMLV reporter virusDepositorInsertMMLV-LTR-firefly luciferase
ExpressionMammalianAvailable SinceSept. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
YEE-BE4max
Plasmid#138157PurposeC-to-T base editorDepositorInsertrAPOBEC1(YEE)-nSpCas9-UGI-UGI
TagsNLSExpressionMammalianMutationWithin rAPOBEC1 W90Y + R126E + R132E; within Cas9…PromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-yZ3EV-Z3pr-yEGFP (RB3579)
Plasmid#69100PurposeURA+ yeast shuttle vector containing yZ3EV TF cassette and a Z3pr driving expression of yEGFPDepositorInsertsyZ3EV cassette
Z3 promoter
yEGFP
ExpressionYeastAvailable SinceSept. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
Flag-Gsdmd
Plasmid#80950PurposeExpresses Gsdmd in mammalian cellsDepositorAvailable SinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC25A39
Plasmid#131970PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC25A39 (SLC25A39 Human)
ExpressionMammalianAvailable SinceOct. 18, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTpPuc3
Plasmid#62864PurposeEpisome vector for Thalassiosira pseudonana (pUC-based)DepositorTypeEmpty backboneUseSynthetic Biology; Episomal vector for thalassios…Available SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
GST-GRP78-Full Length (pGEX4T1)
Plasmid#238421PurposeExpresses GRP78 Full Length fused to the GST TagDepositorAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Zeo_BACE1
Plasmid#227105PurposeBACE1 enzyme overexpression for Nrg1 activation in luciferase and barcode assaysDepositorInsertBACE1 (BACE1 Human)
ExpressionMammalianAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_OT1.0 (AAV1)
Viral Prep#185386-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-GRAB_OT1.0 (#185386). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_OT1.0 plasmid DNA. hSyn-driven expression of the genetically-encoded fluorescent oxytocin(OT) sensor GRAB_OT1.0 in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SFFV-NFE2L1-Puro
Plasmid#181917PurposeLentiviral plasmid that directs the expression of NFE2L1/Nrf1 in mammalian cells.DepositorAvailable SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
ilux pGEX(-)
Plasmid#107879PurposeBacterial expression of ilux for bioluminescence imagingDepositorInsertilux
ExpressionBacterialPromotertacAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBB528
Plasmid#27390DepositorInsertlacIq
ExpressionBacterialAvailable SinceApril 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDonor_e-attP-H1-g3-Ef1a-Puro-P2A-mCherry
Plasmid#247160PurposeEngineered e-attP donor plasmid expressing puromycin resistance and mCherry with donor binding sgRNA H1-g3DepositorInsertPuromycin resistance, mCherry
ExpressionMammalianPromoterEf1aAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAPTURE2_pLVX-EF1a-dCas9-CBio-IRES-zsGreen1
Plasmid#138418PurposeCAPTURE2.0 vector containing dCas9-CBio, IRES and zsGreen1DepositorInsertdCas9
UseLentiviralTagsBioTAP-tagPromoterEF1aAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRetroSuper-shFyn
Plasmid#26985DepositorAvailable SinceDec. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
Mouse genome-wide lentiviral CRISPR gRNA library version 2
Pooled Library#67988PurposeKnockout library targeting 18,424 mouse genes. gRNAs were improved using a new design pipeline and improved gRNA scaffold.DepositorSpeciesHomo sapiens, Mus musculus, and SyntheticUseCRISPR and LentiviralAvailable SinceOct. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
Halo-Sec23A
Plasmid#166892Purposemammalian expression of Sec23A tagged with HaloTagDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
MCHR2-DuET
Plasmid#213338PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only