This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

George Church Lab Plasmids


The George Church Lab has deposited plasmids at Addgene for distribution to the research community. Addgene is a nonprofit plasmid repository dedicated to improving life science research.

Learn more about research in the George Church Lab.

Addgene Alerts

Receive email alerts when new plasmids from this lab become available.

Log in to subscribe to Addgene Alerts.

Title Authors Publication
Targeted gene inactivation in Clostridium phytofermentans shows that cellulose degradation requires the family 9 hydrolase Cphy3367. Tolonen AC, Chilaka AC, Church GM Mol Microbiol. 2009 Dec . 74(6):1300-13.
Programming cells by multiplex genome engineering and accelerated evolution. Wang HH, Isaacs FJ, Carr PA, Sun ZZ, Xu G, Forest CR, Church GM Nature. 2009 Aug 13. 460(7257):894-8.
Improving Lambda Red Genome Engineering in Escherichia coli via Rational Removal of Endogenous Nucleases. Mosberg JA, Gregg CJ, Lajoie MJ, Wang HH, Church GM PLoS One. 2012;7(9):e44638. Epub 2012 Sep 5.
RNA-Guided Human Genome Engineering via Cas9. Mali P, Yang L, Esvelt KM, Aach J, Guell M, Dicarlo JE, Norville JE, Church GM Science. 2013 Jan 3.
Manipulating replisome dynamics to enhance lambda Red-mediated multiplex genome engineering. Lajoie MJ, Gregg CJ, Mosberg JA, Washington GC, Church GM Nucleic Acids Res. 2012 Aug 16.
Barcoding cells using cell-surface programmable DNA-binding domains. Mali P, Aach J, Lee JH, Levner D, Nip L, Church GM Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407.
Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Dicarlo JE, Norville JE, Mali P, Rios X, Aach J, Church GM. Nucleic Acids Res
CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Mali P, Aach J, Stranges PB, Esvelt KM, Moosburner M, Kosuri S, Yang L, Church GM Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675.
Kosuri pGERC reporter plasmid (unpublished)
Church Lab Fatty Acid Production Strains (unpublished)
Genomically recoded organisms expand biological functions. Lajoie MJ, Rovner AJ, Goodman DB, Aerni HR, Haimovich AD, Kuznetsov G, Mercer JA, Wang HH, Carr PA, Mosberg JA, Rohland N, Schultz PG, Jacobson JM, Rinehart J, Church GM, Isaacs FJ Science. 2013 Oct 18;342(6156):357-60. doi: 10.1126/science.1241459.
Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Esvelt KM, Mali P, Braff JL, Moosburner M, Yaung SJ, Church GM Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. Link AJ, Phillips D, Church GM J Bacteriol. 1997 Oct . 179(20):6228-37.
Highly efficient Cas9-mediated transcriptional programming. Chavez A, Scheiman J, Vora S, Pruitt BW, Tuttle M, P R Iyer E, Lin S, Kiani S, Guzman CD, Wiegand DJ, Ter-Ovanesyan D, Braff JL, Davidsohn N, Housden BE, Perrimon N, Weiss R, Aach J, Collins JJ, Church GM Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312.
Synthetic biosensors for precise gene control and real-time monitoring of metabolites. Rogers JK, Guzman CD, Taylor ND, Raman S, Anderson K, Church GM Nucleic Acids Res. 2015 Jul 7. pii: gkv616.
Rational optimization of tolC as a powerful dual selectable marker for genome engineering. Gregg CJ, Lajoie MJ, Napolitano MG, Mosberg JA, Goodman DB, Aach J, Isaacs FJ, Church GM Nucleic Acids Res. 2014 Apr;42(7):4779-90. doi: 10.1093/nar/gkt1374. Epub 2014 Jan 22.
Cas9 gRNA engineering for genome editing, activation and repression. Kiani S, Chavez A, Tuttle M, Hall RN, Chari R, Ter-Ovanesyan D, Qian J, Pruitt BW, Beal J, Vora S, Buchthal J, Kowal EJ, Ebrahimkhani MR, Collins JJ, Weiss R, Church G Nat Methods. 2015 Sep 7. doi: 10.1038/nmeth.3580.
Genetically encoded sensors enable real-time observation of metabolite production. Rogers JK, Church GM Proc Natl Acad Sci U S A. 2016 Feb 8. pii: 201600375.
Comparison of Cas9 activators in multiple species. Chavez A, Tuttle M, Pruitt BW, Ewen-Campen B, Chari R, Ter-Ovanesyan D, Haque SJ, Cecchi RJ, Kowal EJ, Buchthal J, Housden BE, Perrimon N, Collins JJ, Church G Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871.
Molecular recordings by directed CRISPR spacer acquisition. Shipman SL, Nivala J, Macklis JD, Church GM Science. 2016 Jun 9. pii: aaf1175.
A multifunctional AAV-CRISPR-Cas9 and its host response. Chew WL, Tabebordbar M, Cheng JK, Mali P, Wu EY, Ng AH, Zhu K, Wagers AJ, Church GM Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993.
ID Plasmid Gene/Insert Vector Type Publication Hidden Extra Search Info  
25769pKOVBacterial ExpressionMethods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J Bacteriol. 1997 Oct . 179(20):6228-37. pMAK700, pMAK705, pBS-TS Add to Cart
25819pQintqQintbacterial gene inactivationTargeted gene inactivation in Clostridium phytofermentans shows that cellulose degradation requires the family 9 hydrolase Cphy3367. Mol Microbiol. 2009 Dec . 74(6):1300-13. pAT19 Add to Cart
25820pQexppQexpBacterial ExpressionTargeted gene inactivation in Clostridium phytofermentans shows that cellulose degradation requires the family 9 hydrolase Cphy3367. Mol Microbiol. 2009 Dec . 74(6):1300-13. pAT19 Add to Cart
26930EcNR1 StrainE.coli bacterial strainProgramming cells by multiplex genome engineering and accelerated evolution. Nature. 2009 Aug 13. 460(7257):894-8. N/A Add to Cart
26931EcNR2 StrainE.coli bacterial strainProgramming cells by multiplex genome engineering and accelerated evolution. Nature. 2009 Aug 13. 460(7257):894-8. N/A Add to Cart
40802EcNR2.xseA-N/AImproving Lambda Red Genome Engineering in Escherichia coli via Rational Removal of Endogenous Nucleases. PLoS One. 2012;7(9):e44638. Epub 2012 Sep 5. N/A
  • Tag / Fusion Protein
    • N/A
  • Add to Cart
    40803nuc4-N/AImproving Lambda Red Genome Engineering in Escherichia coli via Rational Removal of Endogenous Nucleases. PLoS One. 2012;7(9):e44638. Epub 2012 Sep 5. N/A Add to Cart
    40804nuc5-N/AImproving Lambda Red Genome Engineering in Escherichia coli via Rational Removal of Endogenous Nucleases. PLoS One. 2012;7(9):e44638. Epub 2012 Sep 5. N/A Add to Cart
    41699Nuc5-.dnaG.Q576A.tolC-E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] xonA-, recJ-,xseA-, exoX- and redα- dnaG.Q576A tolC-Manipulating replisome dynamics to enhance lambda Red-mediated multiplex genome engineering. Nucleic Acids Res. 2012 Aug 16. genome Add to Cart
    41700EcNR2.dnaG.Q576AE. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] dnaG.Q576AManipulating replisome dynamics to enhance lambda Red-mediated multiplex genome engineering. Nucleic Acids Res. 2012 Aug 16. genome Add to Cart
    41815hCas9Cas9Mammalian Expression, CRISPRRNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses human codon optimized Cas9 nuclease for genome engineering pcDNA3.3-TOPO Add to Cart
    41816hCas9_D10ACas9_D10AMammalian Expression, CRISPRRNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses human codon optimized Cas9 D10A mutant which functions as a nickase for genome engineering pcDNA3.3-TOPO Add to Cart
    41817gRNA_AAVS1-T1gRNA_AAVS1-T1Mammalian Expression, CRISPRRNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses a guide RNA (gRNA) to target human AAVS1 (T1 target sequence) for genome engineering pCR-Blunt II-TOPO Add to Cart
    41818gRNA_AAVS1-T2gRNA_AAVS1-T2Mammalian Expression, CRISPRRNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses a guide RNA (gRNA) to target human AAVS1 (T2 target sequence) for genome engineering pCR-Blunt II-TOPO Add to Cart
    41819gRNA_GFP-T1gRNA_GFP-T1Mammalian Expression, CRISPRRNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses a guide RNA (gRNA) to target GFP (T1 target sequence) for genome engineering pCR-Blunt II-TOPO Add to Cart
    41820gRNA_GFP-T2gRNA_GFP-T2Mammalian Expression, CRISPRRNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses a guide RNA (gRNA) to target GFP (T2 target sequence) for genome engineering pCR-Blunt II-TOPO Add to Cart
    41821gRNA_DNMT3a-T1gRNA_DNMT3a-T1 (Homo sapiens)Mammalian Expression, CRISPRRNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses a guide RNA (gRNA) to target DNMT3a (T1 target sequence) for genome engineering pCR-Blunt II-TOPO DNMT3A DNMT3A2, M.HsaIIIA, TBRS Add to Cart
    41822gRNA_DNMT3a-T2gRNA_DNMT3a-T2 (Homo sapiens)Mammalian Expression, CRISPRRNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses a guide RNA (gRNA) to target DNMT3a (T2 target sequence) for genome engineering pCR-Blunt II-TOPO DNMT3A DNMT3A2, M.HsaIIIA, TBRS Add to Cart
    41823gRNA_DNMT3bgRNA_DNMT3b (Homo sapiens)Mammalian Expression, CRISPRRNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses a guide RNA (gRNA) to target DNMT3b for genome engineering pCR-Blunt II-TOPO DNMT3B ICF, ICF1, M.HsaIIIB Add to Cart
    41824gRNA_Cloning VectorMammalian Expression, CRISPRRNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. An empty gRNA expression vector, used to create a gRNA to a specific sequence. pCR-Blunt II-TOPO
  • Tag / Fusion Protein
    • AflII site for Gibson Assembly
  • Add to Cart
    43802p414-TEF1p-Cas9-CYC1tHuman Optimized S. pyogenes Cas9 (Homo sapiens)Yeast Expression, CRISPRGenome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res p414 Add to Cart
    43803p426-SNR52p-gRNA.CAN1.Y-SUP4tCAN1.y gRNA (Saccharomyces cerevisiae)Yeast Expression, CRISPRGenome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res Encodes a gRNA that targets Can1.Y in yeast. p426 CAN1 YEL063C Add to Cart
    43804p415-GalL-Cas9-CYC1tHuman Optimized S. pyogenes Cas9 (Homo sapiens)Yeast Expression, CRISPRGenome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res p415 Add to Cart
    43832sZF1sZF1 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    43833sZF2sZF2 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    43834sZF3sZF3 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    43835sZF4sZF4 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    43836sZF5sZF5 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    43837sZF6sZF6 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    43838sZF7sZF7 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    43839sZF8sZF8 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    43840sZF9sZF9 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    43841sZF10sZF10 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    43842sZF11sZF11 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    43843sZF12sZF12 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    43844sZF13sZF13 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    43845sZF14sZF14 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    43846sZF15sZF15 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    43847sZF16sZF16 (Synthetic)Mammalian ExpressionBarcoding cells using cell-surface programmable DNA-binding domains. Nat Methods. 2013 Mar 17. doi: 10.1038/nmeth.2407. pDisplay Add to Cart
    47314Cas9m2Cas9m2 (Other)CRISPRCAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. Cas9 D10A+H840A pcDNA3.3_TOPO Add to Cart
    47315Cas9m3Cas9m3 (Other)CRISPRCAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. Cas9 D10A+D839A+H840A pcDNA3.3_TOPO Add to Cart
    47316Cas9m4Cas9m4 (Other)CRISPRCAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. Cas9 D10A+D839A+H840A+N863A pcDNA3.3_TOPO Add to Cart
    47317Cas9m2-VP64Cas9m2-VP64 (Other)CRISPRCAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. Cas9m2 Activator pcDNA3.3_TOPO Add to Cart
    47318Cas9m3-VP64Cas9m3-VP64 (Other)CRISPRCAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. Cas9m3 Activator pcDNA3.3_TOPO Add to Cart
    47319Cas9m4-VP64Cas9m4-VP64 (Other)CRISPRCAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. Cas9m4 Activator pcDNA3.3_TOPO Add to Cart
    47320reporter-gT1minCMV-dTomato_pA (Other)CRISPRCAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. TF reporter for gRNA-AAVS1_T1 (RNA-guided dTomato expression) pcrBluntII-Topo Add to Cart
    47321reporter-gT2minCMV-dTomato_pA (Other)CRISPRCAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. 2013 Aug 1. doi: 10.1038/nbt.2675. TF reporter for gRNA-AAVS1_T2 (RNA-guided dTomato expression) pcrBluntII-topo Add to Cart
    47441pJ251-GERCGene Expression Reporter Construct (Synthetic)Bacterial Expression Kosuri pGERC reporter plasmid (unpublished) Expresses mCherry and sfGFP from divergent promoters. The backbone is cloned into DNA2.0 pJ251, and the design is based off of pZS2-123. pJ251 Add to Cart
    48645DS-SPcasCas9 (Other), tracrRNA precursor (Other)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial S. pyogenes Cas9 (SP) + tracrRNA expression, cloDF13/spectinomycin cloDF13-aadA Add to Cart
    48646DS-NMcasCas9 (Other), NM tracrRNA (Other)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial N. meningitidis Cas9 (NM) + tracrRNA expression, cloDF13/spectinomycin cloDF13-aadA Add to Cart
    48647DS-ST1casCas9 (Other), ST1 tracrRNA (Other)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial S. thermophilus #1 Cas9 (ST1) + tracrRNA expression, cloDF13/spectinomycin cloDF13-aadA Add to Cart
    48648DS-TDcasCas9 (Other), TD tracrRNA (Other)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial T. denticola Cas9 (TD) + tracrRNA expression, cloDF13/spectinomycin cloDF13-aadA Add to Cart
    48649PM-SP!TABacterial SP crRNA to prototspacer A (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol p15A-cat Add to Cart
    48650PM-SP!TBBacterial SP crRNA to prototspacer B (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol p15A-cat Add to Cart
    48651PM-NM!TABacterial NM crRNA to prototspacer A (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol p15A-cat Add to Cart
    48652PM-NM!TBBacterial NM crRNA to prototspacer B (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol p15A-cat Add to Cart
    48653PM-ST1!TABacterial ST1 crRNA to prototspacer A (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol p15A-cat Add to Cart
    48654PM-ST1!TBBacterial ST1 crRNA to prototspacer B (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol p15A-cat Add to Cart
    48655PM-TD!TABacterial TD crRNA to prototspacer A (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol p15A-cat Add to Cart
    48656PM-TD!TBBacterial TD crRNA to prototspacer B (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol p15A-cat Add to Cart
    48657DS-SPcasN-Cas9, nuclease-null (Other), tracrRNA precursor (Other)Bacterial Expression, CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial nuclease-null SP Cas9 expression cloDF13-aadA Add to Cart
    48659DS-ST1casN-Cas9, nuclease-null (Other), ST1 tracrRNA (Other)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial nuclease-null ST1 Cas9 expression cloDF13-aadA Add to Cart
    48660DS-TDcasN-Cas9, nuclease-null (Other), TD tracrRNA (Other)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial nuclease-null TD Cas9 expression cloDF13-aadA Add to Cart
    48661SK-YFP-SPNM-BSP/NM prototspacer B/PAM with reporter EYFP (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial SP and NM repression YFP reporter: protospacer B pSC101-kan Add to Cart
    48662SK-YFP-ST1-BST1 prototspacer B/PAM with reporter EYFP (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial ST1 repression YFP reporter: protospacer B pSC101-kan Add to Cart
    48663SK-YFP-TD-BTD prototspacer B/PAM with reporter EYFP (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial TD repression YFP reporter: protospacer B pSC101-kan Add to Cart
    48664SK-YFP-NM-ANM prototspacer A/PAM with reporter EYFP (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial NM repression YFP reporter: protospacer A pSC101-kan Add to Cart
    48665SK-YFP-ST1-AST1 prototspacer A/PAM with reporter EYFP (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial ST1 repression YFP reporter: protospacer A pSC101-kan Add to Cart
    48666SK-YFP-TD-ATD prototspacer A/PAM with reporter EYFP (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial TD repression YFP reporter: protospacer A pSC101-kan Add to Cart
    48667EE-SP!gIIICas9 (Other), anti-gIII tracrRNA (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial SP Cas9 targeting filamentous phage gene III at five protospacers colE1-erm Add to Cart
    48668M-SPcasCas9 (Other)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian S. pyogenes Cas9 expression, human optimized pcDNA3.3 TOPO Add to Cart
    48669M-ST1casCas9 (Other)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian S. thermophilus #1 Cas9 expression, human optimized pcDNA3.3 TOPO Add to Cart
    48670M-NMcasCas9 (Other)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian N. meningitidis Cas9 expression, human optimized pcDNA3.3 hygro Add to Cart
    48671M-SP-sgRNAsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTG pCR-BluntII-TOPO Add to Cart
    48672M-ST1-sgRNAsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTG pCR-BluntII-TOPO Add to Cart
    48673M-NM-sgRNAsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTG pCR-BluntII-TOPO Add to Cart
    48674M-SPn-VP64Cas9-VP64, nuclease-null (Other)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian SP-VP64 nuclease-null Cas9 activator expression, human optimized pcDNA3.3 TOPO Add to Cart
    48675M-ST1n-VP64Cas9-VP64, nuclease-null (Other)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian ST1-VP64 nuclease-null Cas9 activator expression, human optimized pcDNA3.3 TOPO Add to Cart
    48676M-NMn-VP64Cas9-VP64, nuclease-null (Other)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian NM-VP64 nuclease-null Cas9 activator expression, human optimized pcDNA3.3 TOPO Add to Cart
    48677M-tdTom-SPTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9 (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacer Unknown Add to Cart
    48678M-tdTom-ST1TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9 (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacer Unknown Add to Cart
    48679M-tdTom-NMTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9 (Synthetic)CRISPROrthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacer Unknown Add to Cart
    48895EcNGRfEfC-R10S1B9galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48896EcNGRfEfC-R10S1C2galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48897EcNGRfEfC-R10S1C5galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48898EcNGRfEfC-R10S1C6galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48899EcNGRfEfC-R10S1C7galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48900EcNGRfEfC-R10S1C8galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48901EcNGRfEfC-R10S1C9galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48902EcNGRfEfC-R10S1C10galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48903EcNGRfEfC-R10S1C11galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48904EcNGRfEfC-R10S1C12galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48905EcNGRfEfC-R10S1E7galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48906EcNGRfEfC-R10S1E8galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48907EcNGRfEfC-R10M1B10galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48908EcNGRfEfC-R10M1C5galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48909EcNGRfEfC-R10M3A2galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48910EcNGRfEfC-R10M3A7galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48911EcNGRfEfC-R10M3A8galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48913EcNGRfEfC-R10M3C1galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48914EcNGRfEfC-R10M3C2galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48915EcNGRfEfC-R6M1A5galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48916EcNGRfEfC-R6M1A11galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48917EcNGRfEfC-R6M1B3galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48918EcNGRfEfC-R6M1B5galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48919EcNGRfEfC-R6M1C6galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48920EcNGRfEfC-R6M1C9galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48921EcNGRfEfC-R6M1D4galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48922EcNGRfEfC-R6M1E2galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48923EcNGRfEfC-R6M1E6galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48924EcNGRfEfC-R6M1G7galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48925EcNGRfEfC-R6M3B7galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48926EcNGRfEfC-R6M3B8galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48927EcNGRfEfC-R6M3C3galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48928EcNGRfEfC-R6M3C4galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48929EcNGRfEfC-R6M3C8galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48930EcNGRfEfC-R6M3E12galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48931EcNGRfEfC-R6M3F12galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48932EcNGRfEfC-R6M3G8galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48933EcNGRfEfC-R6M3H7galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48934EcNGRfEfC-R6M3H12galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) diversity was introduced via homologous recombination to 40 sites to improve fatty acid production. Sequencing of the strains at these sites is ongoing. pZE41 backbone (specR), fadD, tesA' Add to Cart
    48935EcNGRfEmutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) Base line strain is heat shock induce-able lambda red recombination system for MAGE (Multiplex Recombination Genome Engineering) N/A Add to Cart
    48936EcNGRfCgalK::fadBp-CAT, mutS::bla Church Lab Fatty Acid Production Strains (unpublished) Base line strain is heat shock induce-able lambda red recombination system for MAGE (Multiplex Recombination Genome Engineering) N/A Add to Cart
    48937EcNGRfEfCgalK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) Base line strain is heat shock induce-able lambda red recombination system for MAGE (Multiplex Recombination Genome Engineering) N/A Add to Cart
    48938EcNGRfEfC-fadD-tesA'galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) Base line strain is heat shock induce-able lambda red recombination system for MAGE (Multiplex Recombination Genome Engineering) pZE41 backbone (specR), fadD, tesA' Add to Cart
    48939EcNGRfEfC-fadD-tesA'-fadRgalK::fadBp-CAT, mutS::bla, fadE265G>T/268delG Church Lab Fatty Acid Production Strains (unpublished) Base line strain is heat shock induce-able lambda red recombination system for MAGE (Multiplex Recombination Genome Engineering) pZE41 backbone (specR), fadD, tesA',fadR Add to Cart
    48998C321.ΔARecoded E. coli genome with all instances of the UAG codon and RF1 removed (UAG termination function removed) (Other)Bacterial ExpressionGenomically recoded organisms expand biological functions. Science. 2013 Oct 18;342(6156):357-60. doi: 10.1126/science.1241459. Recoded E. coli MG1655 strain with UAG termination function removed (RF1 is deleted) E. coli genome Add to Cart
    48999C321Recoded E. coli genome with all instances of the UAG codon removed, but wild type UAG termination function is not changed (Other)Bacterial ExpressionGenomically recoded organisms expand biological functions. Science. 2013 Oct 18;342(6156):357-60. doi: 10.1126/science.1241459. Recoded E. coli MG1655 strain with wt UAG termination function (RF1 is still present) E. coli genome Add to Cart
    49018C321.ΔA.expRecoded E. coli with all UAG codons and RF1 removed (UAG termination abolished); decreased mutation rate; 37C growth tolerated (Other)Bacterial ExpressionGenomically recoded organisms expand biological functions. Science. 2013 Oct 18;342(6156):357-60. doi: 10.1126/science.1241459. This is C321.DA with mutS reverted and the lambda prophage removed; it exhibits lesser spontaneous mutagenesis and can be grown at 37 C E. coli genome Add to Cart
    62557pJKR-H-cdaRbeta lactamase, sfGFP, CdaRBacterial ExpressionSynthetic biosensors for precise gene control and real-time monitoring of metabolites. Nucleic Acids Res. 2015 Jul 7. pii: gkv616. Glucarate biosensor. High copy plasmid that expresses GFP proportional to glucarate concentration. pUC Add to Cart
    62558pJKR-L-cdaRGFPBacterial ExpressionSynthetic biosensors for precise gene control and real-time monitoring of metabolites. Nucleic Acids Res. 2015 Jul 7. pii: gkv616. Glucarate biosensor. Low copy plasmid that expresses GFP proportional to glucarate concentration. SC101 Add to Cart
    62559pJKR-H-mphRGFPBacterial ExpressionSynthetic biosensors for precise gene control and real-time monitoring of metabolites. Nucleic Acids Res. 2015 Jul 7. pii: gkv616. Macrolide biosensor. High copy plasmid that expresses GFP proportional to macrolide concentration. pUC Add to Cart
    62560pJKR-L-mphRGFPBacterial ExpressionSynthetic biosensors for precise gene control and real-time monitoring of metabolites. Nucleic Acids Res. 2015 Jul 7. pii: gkv616. Macrolide biosensor. Low copy plasmid that expresses GFP proportional to macrolide concentration. SC101 Add to Cart
    62561pJKR-H-tetRGFPBacterial ExpressionSynthetic biosensors for precise gene control and real-time monitoring of metabolites. Nucleic Acids Res. 2015 Jul 7. pii: gkv616. Tetracycline biosensor. High copy plasmid that expresses GFP proportional to tetracycline concentration. pUC Add to Cart
    62562pJKR-L-tetRGFPBacterial ExpressionSynthetic biosensors for precise gene control and real-time monitoring of metabolites. Nucleic Acids Res. 2015 Jul 7. pii: gkv616. Tetracycline biosensor. Low copy plasmid that expresses GFP proportional to tetracycline concentration. SC101 Add to Cart
    62563pJKR-H-araCGFPBacterial ExpressionSynthetic biosensors for precise gene control and real-time monitoring of metabolites. Nucleic Acids Res. 2015 Jul 7. pii: gkv616. Arabinose biosensor. High copy plasmid that expresses GFP proportional to arabinose concentration. pUC Add to Cart
    62565pJKR-H-ttgRGFPBacterial ExpressionSynthetic biosensors for precise gene control and real-time monitoring of metabolites. Nucleic Acids Res. 2015 Jul 7. pii: gkv616. Flavonoid biosensor. High copy plasmid that expresses GFP proportional to flavonoid concentration. pUC Add to Cart
    62566pJKR-L-ttgRGFPBacterial ExpressionSynthetic biosensors for precise gene control and real-time monitoring of metabolites. Nucleic Acids Res. 2015 Jul 7. pii: gkv616. Flavonoid biosensor. Low copy plasmid that expresses GFP proportional to flavonoid concentration. SC101 Add to Cart
    62567pJKR-H-acuRGFPBacterial ExpressionSynthetic biosensors for precise gene control and real-time monitoring of metabolites. Nucleic Acids Res. 2015 Jul 7. pii: gkv616. Acrylate biosensor. High copy plasmid that expresses GFP proportional to acrylate concentration. pUC Add to Cart
    62568pJKR-L-acuRGFPBacterial ExpressionSynthetic biosensors for precise gene control and real-time monitoring of metabolites. Nucleic Acids Res. 2015 Jul 7. pii: gkv616. Acrylate biosensor. Low copy plasmid that expresses GFP proportional to acrylate concentration. SC101 Add to Cart
    62569pJKR-O-acuRCFPBacterial ExpressionSynthetic biosensors for precise gene control and real-time monitoring of metabolites. Nucleic Acids Res. 2015 Jul 7. pii: gkv616. Acrylate biosensor. Medium copy plasmid that expresses CFP proportional to acrylate concentration. Compatible with all other pJKR plasmids. colA Add to Cart
    62570pJKR-O-mphRmCherryBacterial ExpressionSynthetic biosensors for precise gene control and real-time monitoring of metabolites. Nucleic Acids Res. 2015 Jul 7. pii: gkv616. Macrolide biosensor. Medium copy plasmid that expresses GFP proportional to macrolide concentration. Compatible with all other pJKR plasmids. p15a Add to Cart
    63798SP-dCas9-VPRSP-dCas9-VPR (Homo sapiens)Mammalian Expression, CRISPR, Synthetic BiologyHighly efficient Cas9-mediated transcriptional programming. Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312. SP-dCas9 with VP64-p65-Rta (VPR) fused to it's C-terminus; mammalian vector pcDNA3.3 TOPO Add to Cart
    63799M_ST1n_VPRST1-dCas9-VPR (Homo sapiens)Mammalian Expression, CRISPR, Synthetic BiologyHighly efficient Cas9-mediated transcriptional programming. Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312. ST1-dCas9 with VP64-p65-Rta (VPR) fused to it's C-terminus; mammalian vector pcDNA3.3 TOPO Add to Cart
    63800PB-TRE-dCas9-VPRdCas9-VPR (Homo sapiens)Mammalian Expression, CRISPR, Synthetic Biology ; PiggybacHighly efficient Cas9-mediated transcriptional programming. Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312. SP-dCas9-VPR with doxycycline-inducible expression PB-TRE Add to Cart
    63801pAG414GPD-dCas9-VPRdCas9-VPR (Saccharomyces cerevisiae)Yeast Expression, CRISPR, Synthetic BiologyHighly efficient Cas9-mediated transcriptional programming. Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312. pAG414 series plasmid with GPD promoter driving expression of dCas9-VPR; cerevisiae vector pAG414GPD Add to Cart
    63802pAWG-dCas9-VPRSP-dCas9-VPR (Drosophila melanogaster)Insect Expression, CRISPR, Synthetic BiologyHighly efficient Cas9-mediated transcriptional programming. Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312. SP-dCas9 with VP64-p65-Rta (VPR) fused to it's C-terminus; drosophila vector pAWG Add to Cart
    64046pSB700Mammalian Expression, Lentiviral, CRISPR, Synthetic BiologyHighly efficient Cas9-mediated transcriptional programming. Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312. Lentiviral vector for expressing U6 sgRNA and CAGGS Cerulean fluorescent protein pLVX Add to Cart
    64052EcM2.1see commentsRational optimization of tolC as a powerful dual selectable marker for genome engineering. Nucleic Acids Res. 2014 Apr;42(7):4779-90. doi: 10.1093/nar/gkt1374. Epub 2014 Jan 22. Optimized strain for high-efficiency genome manipulations using CoS-MAGE and tolC cycling N/A Add to Cart
    64053EcM2.1.dtolCsee commentsRational optimization of tolC as a powerful dual selectable marker for genome engineering. Nucleic Acids Res. 2014 Apr;42(7):4779-90. doi: 10.1093/nar/gkt1374. Epub 2014 Jan 22. Optimized strain for high-efficiency genome manipulations using CoS-MAGE and tolC cycling N/A Add to Cart
    64054EcM2.1 dtolC bla::zeoRsee commentsRational optimization of tolC as a powerful dual selectable marker for genome engineering. Nucleic Acids Res. 2014 Apr;42(7):4779-90. doi: 10.1093/nar/gkt1374. Epub 2014 Jan 22. Optimized strain for high-efficiency genome manipulations using CoS-MAGE and tolC cycling N/A Add to Cart
    68495AAV_NLS-dSaCas9-NLS-VPRdSaCas9-VPR (Synthetic)Mammalian Expression, AAVCas9 gRNA engineering for genome editing, activation and repression. Nat Methods. 2015 Sep 7. doi: 10.1038/nmeth.3580. AAV vector containing nuclease null SaCas9 fused to VPR pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA Plasmid #61592 Add to Cart
    68496AAV_NLS-SaCas9-NLS-VPRSaCas9-VPR (Synthetic)Mammalian Expression, AAVCas9 gRNA engineering for genome editing, activation and repression. Nat Methods. 2015 Sep 7. doi: 10.1038/nmeth.3580. AAV vector containing SaCas9 fused to VPR pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA Plasmid #61592 Add to Cart
    68497hCas9-VPRSP-Cas9-VPR (Synthetic)Mammalian ExpressionCas9 gRNA engineering for genome editing, activation and repression. Nat Methods. 2015 Sep 7. doi: 10.1038/nmeth.3580. nuclease competent SP-Cas9 fused to VPR hCas9 Plasmid #41815 Add to Cart
    68498M-ST1-VPRST-Cas9-VPR (Synthetic)Mammalian ExpressionCas9 gRNA engineering for genome editing, activation and repression. Nat Methods. 2015 Sep 7. doi: 10.1038/nmeth.3580. nuclease competent ST1-Cas9 fused to VPR M-ST1cas Plasmid #48669 Add to Cart
    73925pJKR-H-benMmuconate biosensing apparatusGenetically encoded sensors enable real-time observation of metabolite production. Proc Natl Acad Sci U S A. 2016 Feb 8. pii: 201600375. Muconate biosensor. Expresses GFP proportional to muconate concentration within the cell. pUC Add to Cart
    73929pMuc1muconate producing enzymesGenetically encoded sensors enable real-time observation of metabolite production. Proc Natl Acad Sci U S A. 2016 Feb 8. pii: 201600375. Muconate expression plasmid. Expresses enzymes enabling production of muconate from glucose. p15a Add to Cart
    79368gRNA_tdtomato_reporter_1_ST1_2x_bindingtdtomato (Synthetic)Mammalian Expression, CRISPRCas9 gRNA engineering for genome editing, activation and repression. Nat Methods. 2015 Sep 7. doi: 10.1038/nmeth.3580. Assays activity of transcriptional activators fused to ST1 Cas9 unknown Add to Cart
    79369gRNA_tdtomato_reporter_1_SA-2xtdtomato (Synthetic)Mammalian Expression, CRISPRCas9 gRNA engineering for genome editing, activation and repression. Nat Methods. 2015 Sep 7. doi: 10.1038/nmeth.3580. Assays activity of transcriptional activators fused to SA Cas9 unknown Add to Cart
    79370gRNA_tdtomato_reporter1_SP-2xtdtomato (Synthetic)Mammalian Expression, CRISPRCas9 gRNA engineering for genome editing, activation and repression. Nat Methods. 2015 Sep 7. doi: 10.1038/nmeth.3580. Assays activity of transcriptional activators fused to SP Cas9 unknown Add to Cart
    79371pcDNA3_3_TOPO_TA-ms2-VP64MS2-VP64 (Synthetic)Mammalian Expression, CRISPRComparison of Cas9 activators in multiple species. Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871. Recruits VP64 to a compatible gRNA for transcriptional activation pcDNA3 Add to Cart
    79372pHRdSV40_scFv_GCN4_sfGFP_p65-hsf1_GB1_NLSGCN4-sfGFP-p65-hsf1 (Synthetic)Mammalian Expression, CRISPRComparison of Cas9 activators in multiple species. Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871. Recruits p65-hsf1 to a compatible Cas9 protein for transcriptional activation pHR Add to Cart
    79373pHRdSV40_scFv_GCN4_sfGFP-VPR-GB1_NLSGCN4-sfGFP-VPR (Synthetic)Mammalian Expression, CRISPRComparison of Cas9 activators in multiple species. Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871. Recruits VPR to a compatible Cas9 protein for transcriptional activation pHR Add to Cart
    79374pLEX_307_ms2_p65_hsf1ms2-p65-hsf1 (Synthetic)Mammalian Expression, CRISPRComparison of Cas9 activators in multiple species. Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871. Recruits p65_hsf1 to compatible gRNAs for transcriptional activation pLEX_307 Add to Cart
    79375pLEX_307_ms2_VP64ms2-VP64 (Synthetic)Mammalian Expression, CRISPRComparison of Cas9 activators in multiple species. Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871. Recruits VP64 to compatible gRNAs for transcriptional activation pLEX_307 Add to Cart
    79376pLEX_307_ms2_VPRms2-VPR (Synthetic)Mammalian Expression, CRISPRComparison of Cas9 activators in multiple species. Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871. Recruits VPR to compatible gRNAs for transcriptional activation pLEX_307 Add to Cart
    79377pSB700 Cerulean-Weissman scaffoldscaffold (Synthetic)Mammalian Expression, CRISPRComparison of Cas9 activators in multiple species. Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871. Cas9 gRNA variant to recruit ms2 proteins pSB700 Add to Cart
    79378pSB700 Cerulean-Zhang2.0zhang 2.0 (Synthetic)Mammalian Expression, CRISPRComparison of Cas9 activators in multiple species. Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871. Cas9 gRNA variant to recruit ms2 proteins pSB700 Add to Cart
    79379pSB700 lenti gRNA Cerulean-zhang2.0-Weiss-chimera1Chimera 1 (Synthetic)Mammalian Expression, CRISPRComparison of Cas9 activators in multiple species. Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871. Cas9 gRNA variant to recruit ms2 proteins pSB700 Add to Cart
    79380pSB700 lenti gRNA Cerulean-zhang2.0-Weiss-chimera2Chimera 2 (Synthetic)Mammalian Expression, CRISPRComparison of Cas9 activators in multiple species. Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871. Cas9 gRNA variant to recruit ms2 proteins pSB700 Add to Cart
    79382pSB700 lenti gRNA Cerulean-zhang2.0-Weiss-chimera4Chimera 4 (Synthetic)Mammalian Expression, CRISPRComparison of Cas9 activators in multiple species. Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871. Cas9 gRNA variant to recruit ms2 proteins pSB700 Add to Cart
    79383pSB700 lenti gRNA Cerulean-zhang2.0 Weiss fullZhang 2.0 + scaffold (Synthetic)Mammalian Expression, CRISPRComparison of Cas9 activators in multiple species. Nat Methods. 2016 May 23. doi: 10.1038/nmeth.3871. Cas9 gRNA variant to recruit ms2 proteins pSB700 Add to Cart
    79879pWUKI 1+2Cas1 (Other), Cas2 (Other), CRISPR Array (Other)Bacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes Cas1+2 and a CRISPR array pCDF-1b Add to Cart
    80088pRSF-DUET Cas1 Cas2Cas1 (Other), Cas2 (Other)Bacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes Cas1 and Cas2 pRSF-DUET1 ygbT b2755, ECK2750, JW2725, cas1 Add to Cart
    80089pWURA Cas1Cas1Bacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes Cas1 pCDF-1b ygbT b2755, ECK2750, JW2725, cas1 Add to Cart
    80090pWUR Cas2Cas2Bacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes Cas2 pCDF-1b ygbF b2754, ECK2749, JW5438, cas2 Add to Cart
    80091pWUKI Cas1 Cas2 E9QCas1, Cas2, CRISPR Array (bp1542-2899)Bacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes Cas1 and Cas2 E9Q pCDF-1b ygbT b2755, ECK2750, JW2725, cas1 ygbF b2754, ECK2749, JW5438, cas2 Add to Cart
    80092pWUKI Cas1 V134L Cas2Cas1, Cas2, CRISPR ArrayBacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes Cas1 V134L and Cas2 pCDF-1b ygbT b2755, ECK2750, JW2725, cas1 ygbF b2754, ECK2749, JW5438, cas2 Add to Cart
    80093pWUKI Cas1 V33A Cas2Cas1, Cas2, CRISPR ArrayBacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes Cas1 V33A and Cas2 pCDF-1b ygbT b2755, ECK2750, JW2725, cas1 ygbF b2754, ECK2749, JW5438, cas2 Add to Cart
    80094pWUKI Cas1 V190I Cas2Cas1, Cas2, CRISPR ArrayBacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes Cas1 V190I and Cas2 pCDF-1b ygbT b2755, ECK2750, JW2725, cas1 ygbF b2754, ECK2749, JW5438, cas2 Add to Cart
    80095pWUKI Cas1 P279L Cas2Cas1, Cas2, CRISPR ArrayBacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes Cas1 P279L and Cas2 pCDF-1b ygbT b2755, ECK2750, JW2725, cas1 ygbF b2754, ECK2749, JW5438, cas2 Add to Cart
    80096pWUKI Cas1 P202Q Cas2Cas1, Cas2, CRISPR ArrayBacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes Cas1 P202Q and Cas2 pCDF-1b ygbT b2755, ECK2750, JW2725, cas1 ygbF b2754, ECK2749, JW5438, cas2 Add to Cart
    80097pWUKI Cas1 P212L Cas2Cas1, Cas2, CRISPR ArrayBacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes Cas1 P212L and Cas2 pCDF-1b ygbT b2755, ECK2750, JW2725, cas1 ygbF b2754, ECK2749, JW5438, cas2 Add to Cart
    80098pWUKI Cas1 P282L Cas2Cas1, Cas2, CRISPR ArrayBacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes Cas1 P282L and Cas2 pCDF-1b ygbT b2755, ECK2750, JW2725, cas1 ygbF b2754, ECK2749, JW5438, cas2 Add to Cart
    80099pWUKI Cas1 P294H Cas2Cas1, Cas2, CRISPR ArrayBacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes Cas1 P294H and Cas2 pCDF-1b ygbT b2755, ECK2750, JW2725, cas1 ygbF b2754, ECK2749, JW5438, cas2 Add to Cart
    80100pWUKI Cas1 Cas2 T72ICas1, Cas2, CRISPR ArrayBacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes Cas1 and Cas2 T72I pCDF-1b ygbT b2755, ECK2750, JW2725, cas1 ygbF b2754, ECK2749, JW5438, cas2 Add to Cart
    80101pWUKI Cas1 Cas2 G74ACas1, Cas2, CRISPR ArrayBacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes Cas1 and Cas2 G74A pCDF-1b ygbT b2755, ECK2750, JW2725, cas1 ygbF b2754, ECK2749, JW5438, cas2 Add to Cart
    80102pWUR 1+2 tetO mut89Cas1, Cas2, Cas1, Cas2Bacterial ExpressionMolecular recordings by directed CRISPR spacer acquisition. Science. 2016 Jun 9. pii: aaf1175. Encodes a set of wild-type Cas1+2 and a mutant set of Cas1+2 pCDF-1b ygbT b2755, ECK2750, JW2725, cas1 ygbF b2754, ECK2749, JW5438, cas2 ygbT b2755, ECK2750, JW2725, cas1 ygbF b2754, ECK2749, JW5438, cas2 Add to Cart
    80930pAAV-SMVP-Cas9NCas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologyA multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9N in mammalian cells. pZac2.1 Add to Cart
    80931pAAV-SMVP-Cas9CCas9C (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologyA multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9C in mammalian cells. pZac2.1 Add to Cart
    80932pAAV-CASI-Cas9CCas9C (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologyA multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9C in mammalian cells; derived from pZac2.1 with CASI promoter. pZac2.1 Add to Cart
    80933pAAV-CMV-Cas9C-VPRCas9C-VPR (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologyA multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9C-VPR in mammalian cells. pZac2.1 Add to Cart
    80934pSMVP-Cas9NCas9N (Synthetic)Mammalian Expression, CRISPR, Synthetic BiologyA multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Plasmid that expresses Cas9N in mammalian cells. pMAX Add to Cart
    80935pSMVP-Cas9C-P2A-turboGFPCas9C (Synthetic)Mammalian Expression, CRISPR, Synthetic BiologyA multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Plasmid that expresses Cas9C in mammalian cells; co-expresses turboGFP. pMAX Add to Cart
    80936pAAV-SMVP-Cas9N-U6-gRNA M3Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologyA multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9N in mammalian cells; expresses gRNA M3 for Mstn cleavage. pZac2.1 Add to Cart
    80937pAAV-SMVP-Cas9N-U6-gRNA M4Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologyA multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9N in mammalian cells; expresses gRNA M4 for Mstn cleavage. pZac2.1 Add to Cart
    80938pAAV-SMVP-Cas9N-U6-gRNA TdLCas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologyA multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9N in mammalian cells; expresses gRNA TdL for Ai9 cleavage. pZac2.1 Add to Cart
    80939pSMVP-Cas9CCas9C (Synthetic)Mammalian Expression, CRISPR, Synthetic BiologyA multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Plasmid that expresses Cas9C in mammalian cells. pMAX Add to Cart
    80940pAAV-SMVP-Cas9N-U6-gRNA TdRCas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologyA multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9N in mammalian cells; expresses gRNA TdR for Ai9 cleavage. pZac2.1 Add to Cart
    80941pSMVP-Cas9FL-P2A-turboGFPCas9FL (Synthetic)Mammalian Expression, CRISPR, Synthetic BiologyA multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Plasmid that expresses Cas9FL in mammalian cells; co-expresses turboGFP. pMAX Add to Cart
    80942pAAV-CASI-Cas9C-P2A-turboGFPCas9C (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologyA multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9C in mammalian cells; co-expresses turboGFP. pZac2.1 Add to Cart
    80943pAAV-SMVP-Cas9N-U6-gRNA P1Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologyA multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9N in mammalian cells; expresses gRNA P1 for Pd-l1 binding. pZac2.1 Add to Cart
    80944pAAV-SMVP-Cas9N-U6-gRNA P2Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic BiologyA multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9N in mammalian cells; expresses gRNA P2 for Pd-l1 binding pZac2.1 Add to Cart