-
PurposeCRISPR-dCas9-VPR vector for Yarrowia lipolytica, expressing dCas9-VPR and AvrII site for sgRNA insertion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107677 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2623
- Total vector size (bp) 13375
-
Vector typeYeast Expression, CRISPR, Synthetic Biology
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCodon optimized dCas9-VPR
-
SpeciesSynthetic
-
Insert Size (bp)5715
- Promoter UAS1B8-TEF(136)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAAAACGACGGCCAGT
- 3′ sequencing primer CAGGAAACAGCTATGAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesgRNA expression cassette
-
SpeciesSynthetic
-
Insert Size (bp)525
- Promoter SCR1'-tRNA
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCATTTATCAGGGTTATTGTCTCATGAG
- 3′ sequencing primer CACGAGCAGCTTGCCTATG (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene material #44380 (UAS1B8-TEF promoter) is used to express Cas9
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPRa_VPR_yl was a gift from Ian Wheeldon (Addgene plasmid # 107677 ; http://n2t.net/addgene:107677 ; RRID:Addgene_107677) -
For your References section:
Multiplexed CRISPR activation of cryptic sugar metabolism enables Yarrowia lipolytica growth on cellobiose. Schwartz C, Curtis N, Lobs AK, Wheeldon I. Biotechnol J. 2018 May 5:e1700584. doi: 10.1002/biot.201700584. 10.1002/biot.201700584 PubMed 29729131