We narrowed to 14,321 results for: cas9
-
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgAP2S1 #2
Plasmid#202757PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2S1DepositorInsertgRNA targeting AP2S1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgAP2M1
Plasmid#202758PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2M1DepositorInsertgRNA targeting AP2M1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgAP2S1 #1
Plasmid#202756PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2S1DepositorInsertgRNA targeting AP2S1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LC3B sgRNA
Plasmid#207556PurposepX330 expressing Cas9 and a sgRNA targeting the LC3B locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKDC.109
Plasmid#227189PurposeT7 IPTG-driven Cas9DepositorInsertSpyCas9
ExpressionBacterialAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available sinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorInsertCGCGCGCCCAGCCATGAACC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMpGE010-gR082
Plasmid#188553PurposeBinary vector for CRISPR/Cas9 targeted to MpIGPD in Marchantia polymorpha (for Agrobacterium-mediated genetic transformation)DepositorInsertgR082
UseCRISPR and Gateway CloningAvailable sinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tbx21 gRNA#2
Plasmid#170838PurposeCas9-mediated knockout of Tbx21 in mammalian cellsDepositorAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tbx21 gRNA#3
Plasmid#170839PurposeCas9-mediated knockout of Tbx21 in mammalian cellsDepositorAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tbx21 gRNA#1
Plasmid#170837PurposeCas9-mediated knockout of Tbx21 in mammalian cellsDepositorAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Drosha_3
Plasmid#79862PurposeCRISPR/Cas9 DROSHADepositorInsertsgRNA Drosha
UseCRISPR and Mouse TargetingExpressionBacterial and MammalianAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_SDHA
Plasmid#177980Purposelentiviral vector expressing Cas9 and a sgRNA targeting SDHADepositorInsertsgRNA targeting SDHA (SDHA Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_UQCRC2
Plasmid#177982Purposelentiviral vector expressing Cas9 and a sgRNA targeting UQCRC2DepositorInsertsgRNA targeting UQCRC2 (UQCRC2 Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRepair-MPP8_mAID-P2A-BFP
Plasmid#175036PurposeHomology Directed Repair construct for C-terminal tagging of mMPP8 with mAID using CRISPR/Cas9DepositorInsertmAID-P2A-BFP
UseHdr donor templateAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only