We narrowed to 3,621 results for: biorxiv
-
Plasmid#211904PurposeVector for AAV6 donor production. Targeted CD19-CAR-28z-2A-EGFP transgene integration to the MTOR locus with the dominant rapamycin resistance MTOR-F2108L mutation via homology-directed repair.DepositorInsertCD19-CAR-28z-2A-EGFP
UseAAVExpressionMammalianPromoterhPGK1Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR2_DAZL-T2A-mGreenLantern-PuroTK
Plasmid#222917PurposeHomology directed repair template for knocking in mGreenLantern reporter to DAZL.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
SynNotch TMD/Gal4-VP64 ICD (MTK 3b) (pAN1031)
Plasmid#194222PurposeMammalian Toolkit part 3b encoding SynNotch and GAL4-VP64 to be used in designing modular receptorsDepositorInsertSynNotch-GAL4 DBD-VP64 AD
UseSynthetic BiologyPromoterNoneAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
T2A-mCherry (MTK 4a) (pAN3844)
Plasmid#194223PurposeMammalian Toolkit part 4a encoding a T2A polycistronic element followed by mCherryDepositorInsertT2A-mCherry
UseSynthetic BiologyPromoterNoneAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
PGK-LCB1_v1.3-NotchGal4VP64-T2A-mCherry (pZYW046)
Plasmid#194229PurposeLentiviral expression vector expressing LCB1 SynNotch and mCherry transduction markerDepositorInsertPGK-LCB1-SynNotch-T2A-mCherry
UseLentiviralPromoterPGKAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1303-AAV-EFSNC-dCjCas9-MECP2(204-310)
Plasmid#223148PurposeExpression of truncated MECP2 with dCjCas9 and empty gRNA scaffoldDepositorInsertMECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310PromoterEF1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV-FLAG-TurboID-mutKIR-SQSTM1
Plasmid#223719PurposeExpresses FLAG-TurboID-mutKIR-SQSTM1DepositorInsertSQSTM1 (SQSTM1 Human)
UseLentiviralTagsTurboIDExpressionMammalianMutationMutation 347-DPSTGE-352 to 347-APSAAA-352PromoterSFFVAvailable SinceAug. 28, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSBL_DK202
Plasmid#156426PurposeMammalian expression of 3a delta N(aa 42-275)-EGFP with CMV promoter, can be used for transfection or used to generate bacmids for baculoviral infection of mammalian cellsDepositorInsertSARS-CoV-2 3a protein (aa 42-275)
TagsEGFP-HisExpressionMammalianMutationaa 42-275PromoterCMVAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-SARS-CoV-2 SL1 alone-Luciferase
Plasmid#191482PurposeLuciferase reporter for SARS-CoV-2 5' UTR SL1 aloneDepositorInsertSARS-CoV-2 5' UTR SL1 alone
UseLentiviral and LuciferaseMutationContains only the stem-loop1 region of SARS-CoV-2…Available SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2T CAG dCas9-10XGcn4-P2A-mCherry BlastR
Plasmid#186745PurposedCas9-10XGcn4-P2A-mCherry expression constructDepositorInsertCas9-10XGcn4-P2A-mCherry
UseCRISPRExpressionMammalianAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-puro-mycProm-EGFP-MYC-U
Plasmid#255432PurposeGFP-tagged MYC with its own 3'UTRDepositorAvailable SinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV_RHOT1 sgRNA_dCas9-KRAB-T2A-EGFP
Plasmid#253810PurposeExpress RHOT1 sgRNA under U6 promoter and dCas9-KRAB-T2A-EGFP under hUbC promoterDepositorInsertsgRNA RHOT1 (RHOT1 Human)
UseCRISPR and LentiviralExpressionMammalianPromotersgRNA for U6p and dCas9-KRAB-T2A-GFP for hUbCpAvailable SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_AAVS1_sg1
Plasmid#254529PurposeAAVS1 knockout, control guideDepositorInsertAAVS1
UseCRISPR and LentiviralTagsFLAG-SV40NLS and nucleoplasminNLS-P2A-GFPAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_AAVS1_sg2
Plasmid#254530PurposeAAVS1 knockout, control guideDepositorInsertAAVS1
UseCRISPR and LentiviralTagsFLAG-SV40NLS and nucleoplasminNLS-P2A-GFPAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_AAVS1_sg3
Plasmid#254531PurposeAAVS1 knockout, control guideDepositorInsertAAVS1
UseCRISPR and LentiviralTagsFLAG-SV40NLS and nucleoplasminNLS-P2A-GFPAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_ROSA26_sg1
Plasmid#254532PurposeROSA26 control guideDepositorInsertROSA26
UseCRISPR and LentiviralTagsFLAG-SV40NLS and nucleoplasminNLS-P2A-GFPAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET28a-6xHis-SSF1
Plasmid#255298PurposeSSF1 (1-473) with an N-terminal 6X poly-histidine tag and a TEV recognition site sub-cloned into pET28 plasmids with Kanamycin bacterial resistance, were used for protein expressionDepositorAvailable SinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET28a-6xHis-SURF6-C19S
Plasmid#255297PurposeSingle cysteine mutant (C19S) of SURF6 (1-361) with an N-terminal 6X poly-histidine tag and a TEV recognition site sub-cloned into pET28 plasmids with Kanamycin bacterial resistance.DepositorInsertSURF6-C19S (SURF6 Human)
Tags6x-HisExpressionBacterialMutationMutated cysteine 19 to serinePromoterT7Available SinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only