We narrowed to 17,026 results for: puromycin
-
Plasmid#170488PurposeSPELL Vav2(DH-PH-ZnF). Two components cloned into the same plasmid with T2A/P2A sequence. Component 2-T2A-P2A-Component 1DepositorInsertFRB, Vav2(C-lobe), iFKBP, Vav2(N-lobe), mCherry
UseRetroviralExpressionMammalianAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-exon1
Plasmid#177261PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-5’UTR
Plasmid#177260PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dNrg1
Plasmid#173696PurposeA knockout vector for the dog Nrg1.DepositorInsertA gRNA targeting the dog Nrg1 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEreg
Plasmid#173697PurposeA knockout vector for the dog Ereg.DepositorInsertA gRNA targeting the dog Ereg gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTgfa
Plasmid#173698PurposeA knockout vector for the dog Tgfa.DepositorInsertA gRNA targeting the dog Tgfa gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dHbegf
Plasmid#173699PurposeA knockout vector for the dog Hbegf.DepositorInsertA gRNA targeting the dog Hbegf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEgf
Plasmid#173700PurposeA knock-out vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-puro-dEgfr
Plasmid#173844PurposeA knockout vector for the dog Egfr.DepositorInsertA gRNA targeting the dog Egfr gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-UbC-canisEgf
Plasmid#173845PurposeEncoding dog Egf.DepositorInsertA cDNA of canis EGF.
ExpressionMammalianMutationR1127Q- please see dep. commentsAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Ptgfr
Plasmid#170303PurposeA knock-out vector for the mouse PtgfrDepositorInsertA gRNA targeting the mouse Ptgfr gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPC-N-Myc-Flag-BirA-hPOT1-DeltaOB
Plasmid#166410Purposeexpress BirA-hPOT1 ΔOB in mammalian cellsDepositorAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
Clim-DC2-H2B2-Venus
Plasmid#129556PurposepClimDC-H2B:mV nuclear markerDepositorInsertHistone 2B fused to venus
ExpressionBacterialAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJC2-GPT1-3xFLAG
Plasmid#163446Purposelentiviral overexpression vector for human GPT1DepositorInsertGPT1 (GPT Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationSee: commentsPromoterCMVAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
GSX2-P2A-tGFP-DTA
Plasmid#161750PurposetGFP plasmid for the c-terminal targeting of human GSX2 locusDepositorInsertturboGFP
UseCRISPRTagsP2A-tGFPExpressionMammalianPromoterendogenous GSX2 promoterAvailable SinceDec. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shSpc25
Plasmid#160960PurposeSpc25 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shNuf2
Plasmid#160961PurposeNuf2 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Puro shRNA INPP5E KD2
Plasmid#162005PurposeINPP5E shRNADepositorInsertINPP5E (INPP5E Canis Lupus)
UseLentiviralAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.DIS3L2-3
Plasmid#128764PurposeExpresses DIS3L2 gRNA for CRISPRiDepositorAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only